RPB0582

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Angiostrongylus cantonensis Angiostrongylus cantonensis,Pulmonema cantonensis 6313 Rhabditida Metastrongylidae Angiostrongylus Angiostrongylus cantonensis Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F 5′⁃TACGATCGATGATGTAGTGGTGGGTGGGTGGTTG⁃3′ 34 420nmol\L 52.94  67.3 10695.96 \
R 5′ ⁃ TAGCGACATAGCCGCCAAATTATCATCAC⁃ CATC⁃3′ 33 420nmol\L 45.45  63.07 10010.59 \
P 5′⁃TGTGATCAACAACGAGAAACCACCAACACATATACACGTTCACCTAGT⁃3′ 48 120nmol\L 41.67 66.64 14650.62 \

Gene Description

Target Gene GenBank ID
ITS1 gene GU733321

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
A simple, rapid fluorescent RAA assay has been successfully established, which has a high sensitivity and specificity for the nucleic acid detection of A. cantonensis. RAA Amplfix 20 min 37°C \ 10 copies\µL of recombinant plasmids and 100 pg\µL of genomic DNA \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2020 Establishment of a recombinase-aided isothermal amplification assay for nucleic acid detection of Angiostrongylus cantonensis Q Zhang,X Ding,Y H Liu,J F Liu,X Z Xu,Q J Ying,Y Dai,J Cao Zhongguo xue xi chong bing fang zhi za zhi = Chinese journal of schistosomiasis control 32935507 10.16250/j.32.1374.2020091

Establishment of a recombinase-aided isothermal amplification assay for nucleic acid detection of Angiostrongylus cantonensis

Author(s):

Q Zhang,X Ding,Y H Liu,J F Liu,X Z Xu,Q J Ying,Y Dai,J Cao

Journal:

Zhongguo xue xi chong bing fang zhi za zhi = Chinese journal of schistosomiasis control

Year:

2020

Abstract:

Objective: To establish a recombinase-aided isothermal amplification (RAA) assay for the nucleic acid detection of Angiostrongylus cantonensis. Methods: The internal transcribed spacer-1 (ITS1) gene sequence of A. cantonensis was used as the detection target sequence, and the specific primers and probes were designed and synthesized, followed by screening of the primers and probes with the highest specificity, to establish the basic and fluorescent RAA assay for nucleic acid detection of A. cantonensis. The sensitivity of the fluorescent RAA assay was evaluated by using the target gene fragment sequence-contained recombinant plasmids at various copy numbers and the genomic DNA from A. cantonensis as the template DNA samples, and the specificity of the fluorescent RAA assay was evaluated by using the genomic DNA from A. cantonensis, Schistosoma mansoni, Ascaris lumbricoides, Clonorchis sinensis, Echinococcus granulosus and Ancylostoma duodenale, as well as Pomacea canaliculata and Biomphalaria straminea snail tissues as the template DNA samples. Results: A fluorescent RAA assay was successfully established for nucleic acid detection of A. cantonensis, which achieved real-time amplification of the specific DNA fragment of A. cantonensis within 20 min at 37 ℃. By using the target gene fragment sequence-contained recombinant plasmids at various copy numbers and the genomic DNA from A. cantonensis as the DNA templates, the lowest detection limits of the fluorescent RAA assay were 10 copies/μL of recombinant plasmids and 100 pg/μL of genomic DNA, respectively. The fluorescent RAA assay was negative for detection of the genomic DNA from A. cantonensis, S. mansoni, A. lumbricoides, C. sinensis, E. granulosus, A. duodenale, and P. canaliculata and B. straminea snail tissues. Conclusions: A simple, rapid fluorescent RAA assay has been successfully established, which has a high sensitivity and specificity for the nucleic acid detection of A. cantonensis.