RPB0580

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Angiostrongylus cantonensis Angiostrongylus cantonensis,Pulmonema cantonensis 6313 Rhabditida Metastrongylidae Angiostrongylus Angiostrongylus cantonensis Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
62F ACAAAACACAAACAACTAGCATCATCTACG 30 \ 36.67  56.96 9114.05 \
154R ACGTGTATATGTGTTGGTGGTTTCTCGTTG 30 \ 43.33  60.37 9296.06 \
P GATCGATGATGTAGTGGTGGGTGGGTGGTTGA3HA1GAGAGAATGTGATCAACCC 52 \ 50.00  70.84 16323.61 \
62F ACAAAACACAAACAACTAGCATCATCTACG 30 \ 36.67  56.96 9114.05 \
154R-biotin ACGTGTATATGTGTTGGTGGTTTCTCGTTG-Biotin 30 \ 43.33  60.37 9296.06 \
RPA-LFA Probe GATCGATGATGTAGTGGTGGGTGGGTGGTTGATHATGAGAGAATGTGATCAACCC-FAM 54 \ 48.15  70.08 16932.01 \

Gene Description

Target Gene GenBank ID
ITS1 gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
In situations where a rapid, inexpensive detection method is needed for A. cantonensis, our RPA-EXO and RPA-LFA assays provide reliable alternatives to qPCR with samples expected to have higher target DNA concentrations. RPA-EXO Geneious 8.1.9 15 min 40°C EXO 25 copies μL−1 \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2021 Development of a recombinase polymerase amplification (RPA-EXO) and lateral flow assay (RPA-LFA) based on the ITS1 gene for the detection of Angiostrongylus cantonensis in gastropod intermediate hosts Susan I Jarvi,Elizabeth S Atkinson,Lisa M Kaluna,Kirsten A Snook,Argon Steel Parasitology 33143812 10.1017/S0031182020002139

Development of a recombinase polymerase amplification (RPA-EXO) and lateral flow assay (RPA-LFA) based on the ITS1 gene for the detection of Angiostrongylus cantonensis in gastropod intermediate hosts

Author(s):

Susan I Jarvi,Elizabeth S Atkinson,Lisa M Kaluna,Kirsten A Snook,Argon Steel

Journal:

Parasitology

Year:

2021

Abstract:

Angiostrongylus cantonensis is a parasitic nematode known to infect humans through the ingestion of third stage larvae which can cause inflammation and damage to the central nervous system. Currently, polymerase chain reaction (PCR) is one of the most reliable diagnostic methods for detecting A. cantonensis in humans as well as in gastropod hosts, but requires expensive and specialized equipment. Here, we compare the sensitivity and accuracy of a recombinase polymerase amplification Exo (RPA-EXO) assay, and a recombinase polymerase amplification lateral flow assay (RPA-LFA) with a traditional quantitative PCR (qPCR) assay currently available. The three assays were used to test 35 slugs from Hawai'i for the presence of A. cantonensis DNA. Consistent results among the three tests were shown in 23/35 samples (65.7%), while 7/35 (20%) were discordant in low infection level samples (<0.01 larvae per mg tissue), and 5/35 (14.3%) were equivocal. To evaluate sensitivity, a partial ITS1 gene was cloned, and serial plasmid dilutions were created ranging from 100 copies μL-1 to ~1 copy μL-1. All three assays consistently detected 50-100 copies μL-1 in triplicate and qPCR was able to detect ~13 copies μL-1 in triplicate. RPA-EXO was able to detect 25 copies μL-1 in triplicate and RPA-LFA was not able to amplify consistently below 50 copies μL-1. Thus, our RPA-EXO and RPA-LFA assays do not appear as sensitive as the current qPCR assay at low DNA concentrations; however, these tests have numerous advantages that may make them useful alternatives to qPCR.