RPB0579

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Cryptococcus neoformans Cryptococcus neoformans,Saccharomyces neoformans,Torula neoformans,Blastomyces neoformans,Torulopsis neoformans,Debaryomyces neoformans,Lipomyces neoformans,Filobasidiella neoformans 5207 Tremellales Cryptococcaceae Cryptococcus Cryptococcus neoformans Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F2 GTCCATTTATCTACCCATCTACACC 25 \ 44.00  54.4 7471.93 \
R2 CAATTCACATTACTTATCGCATTTC 25 \ 32.00  49.79 7525.98 \

Gene Description

Target Gene GenBank ID
ITS \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
In this study, a rapid detection method for Cryptococcus neoformans and Cryptococcus gattii species complexes was developed based on CRISPR-Cas12a technology, characterized by its high sensitivity and specificity, ease of use, and cost-effectiveness, making it suitable for on-site detection. RPA-Cas12a-fluorescence analysis\RPA-Cas12a-immunochromatographic Primer Premier 5.0 20 min 37°C Cas12a-fluorescence analysis\Cas12a-immunochromatographic 102copies/μL. \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Establishment and methodological evaluation of a rapid detection method for Cryptococcus neoformans and Cryptococcus gattii species complexes based on CRISPR-Cas12a technology Runde Liu,Yuqing Xing,Jilu Shen Journal of microbiological methods 39182694 10.1016/j.mimet.2024.107026

Establishment and methodological evaluation of a rapid detection method for Cryptococcus neoformans and Cryptococcus gattii species complexes based on CRISPR-Cas12a technology

Author(s):

Runde Liu,Yuqing Xing,Jilu Shen

Journal:

Journal of microbiological methods

Year:

2024

Abstract:

Purpose: The opportunistic pathogens causing Cryptococcal meningitis are Cryptococcus neoformans and Cryptococcus gattii species complexes. At present, clinical detection methods for this condition include culture, ink staining, and cryptococcal antigen detection. In addition, enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), and real-time quantitative PCR (qPCR) can be applied for the detection of Cryptococcus. Nevertheless, these methods cannot achieve point-of-care detection (POCT); thus, there is a pressing need to establish a fast, sensitive, and effective detection method. Methods: Recombinase polymerase amplification (RPA) and clustered regularly spaced short palindromic repeat (CRISPR) techniques are effective tools for achieving rapid POCT. In this study, RPA was combined with CRISPR-Cas12a to establish a fast, sensitive, and specific detection method for cryptococcal meningitis. Results: This study included RPA-Cas12a fluorescence detection and RPA-Cas12a immunochromatographic detection, which can be performed within 50 min. Moreover, the detection limit was as low as 102 copies/μL. Interestingly, the developed method demonstrated satisfactory specificity and no cross-reactivity with other fungi and bacteria. 36 clinical samples were tested, and the consistency between the test results and those obtained using the commonly used clinical culture method was 100 %. Conclusion: In this study, a rapid detection method for Cryptococcus neoformans and Cryptococcus gattii species complexes was developed based on CRISPR-Cas12a technology, characterized by its high sensitivity and specificity, ease of use, and cost-effectiveness, making it suitable for on-site detection.