RPB0578

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Cryptococcus neoformans Cryptococcus neoformans,Saccharomyces neoformans,Torula neoformans,Blastomyces neoformans,Torulopsis neoformans,Debaryomyces neoformans,Lipomyces neoformans,Filobasidiella neoformans 5207 Tremellales Cryptococcaceae Cryptococcus Cryptococcus neoformans Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F4 TGAACTGTTTATGTGCTTCGGCACGTTTTAC 31 \ 41.94  60.89 9498.21 \
R4 Biotin-TCGATGTGGAAGCCAAGAGATCCGTTGTTG 30 \ 50.00  64.11 9302.09 \
P FITC-TACACAAACTTCTAAATGTAATGAATGTAATC(H)TATTATAACA ATAATAAA-P 50 \ 18.00  53.35 15358.15 \

Gene Description

Target Gene GenBank ID
ITS \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
The LF-RPA system described here is shown to be a sensitive and specific method for the visible, rapid, and accurate detection of Cryptococcus spp. in cerebral spinal fluid and might be useful for clinical preliminary screening of cryptococcal meningitis. LF-RPA \ 30 min 39 °C LF 0.64 pg per reaction 0.952 0.958

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2019 Development of a lateral flow recombinase polymerase amplification assay for rapid and visual detection of Cryptococcus neoformans\C. gattii in cerebral spinal fluid Qinglin Ma,Jilong Yao,Shixin Yuan,Houming Liu,Ning Wei,Jianming Zhang,Wanshui Shan BMC infectious diseases 30717679 10.1186/s12879-019-3744-6

Development of a lateral flow recombinase polymerase amplification assay for rapid and visual detection of Cryptococcus neoformans\C. gattii in cerebral spinal fluid

Author(s):

Qinglin Ma,Jilong Yao,Shixin Yuan,Houming Liu,Ning Wei,Jianming Zhang,Wanshui Shan

Journal:

BMC infectious diseases

Year:

2019

Abstract:

Background: For definitive diagnosis of cryptococcal meningitis, Cryptococcus neoformans and/or C. gattii must be identified within cerebral spinal fluid from the patients. The traditional methods for detecting Cryptococcus spp. such as India ink staining and culture are not ideal. Although sensitive and specific enough, detection of cryptococcal antigen polysaccharide has a high dose hook effect. Therefore, the aim of this study was to introduce a new rapid and simple detection method of Cryptococcus neoformans and C. gattii in cerebral spinal fluid. Methods: The lateral flow strips combined with recombinase polymerase amplification (LF-RPA) assay was constructed to detect the specific DNA sequences of C. neoformans and C. gattii. The detection limit was evaluated using serial dilutions of C. neoformans and C. gattii genomic DNA. The specificity was assessed by excessive amount of other pathogens genomic DNA. The optimal detection time and amplification temperature were also analyzed. The diagnostic parameters were first calculated using 114 clinical specimens and then compared with that of other diagnostic method. A brief analysis and comparison of different DNA extraction methods was discussed, too. Results: The LF-RPA assay could detect 0.64 pg of genomic DNA of C. neoformans per reaction within 10 min and was highly specific for Cryptococcus spp.. The system could work well at a wide range of temperature from 25 to 45 °C. The overall sensitivity and specificity were 95.2 and 95.8% respectively. As amplification template for LF-RPA assay, both cell lysates and genomic DNA produce similar experimental results. Conclusions: The LF-RPA system described here is shown to be a sensitive and specific method for the visible, rapid, and accurate detection of Cryptococcus spp. in cerebral spinal fluid and might be useful for clinical preliminary screening of cryptococcal meningitis.