RPB0577

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Cryptococcus neoformans Cryptococcus neoformans,Saccharomyces neoformans,Torula neoformans,Blastomyces neoformans,Torulopsis neoformans,Debaryomyces neoformans,Lipomyces neoformans,Filobasidiella neoformans 5207 Tremellales Cryptococcaceae Cryptococcus Cryptococcus neoformans Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F2 GTGAATGTGATTGAGACCGTGGATATTGTTAATG 34 \ 38.24  58.6 10606.95 \
R2 AGACATGACAACAGAGAACAAGTCATAAGGAG 32 \ 40.63 59.12 9941.58  \
P FITC-GTGAATATGATTGAGACCGTGGATATTGATAATG[THF]CCACAATGAGTAGTA-\C3-spacer\ 49 \ 36.73  62.96 15246.98 \

Gene Description

Target Gene GenBank ID
CAP64 gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
In our study, RPA- lateral flow strip (LFS) was used to amplify the capsule-associated gene, CAP64, of C. neoformans\C. gattii, and the primer-probe design was optimized by introducing base mismatches to obtain a specific and sensitive primer-probe combination for clinical testing, and specificity of the detection system was determined for 26 common clinical pathogens. RPA-LFS Primer Premier 5.0 20 min 37°C LFS 10 CFU/μL or 1 fg/μL. \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Development and Application of Rapid Clinical Visualization Molecular Diagnostic Technology for Cryptococcus neoformans\ C. gattii Based on Recombinase Polymerase Amplification Combined With a Lateral Flow Strip Lei Wang,Yan Wang,Fang Wang,Mengdi Zhao,Xuzhu Gao,Huimin Chen,Na Li,Qing Zhu,Lipin Liu,Wenjun Zhu,Xia Liu,Yujiao Chen,Ping Zhou,Yingzhi Lu,Kun Wang,Weiguo Zhao,Wei Liang Frontiers in cellular and infection microbiology 35096653 10.3389/fcimb.2021.803798

Development and Application of Rapid Clinical Visualization Molecular Diagnostic Technology for Cryptococcus neoformans\ C. gattii Based on Recombinase Polymerase Amplification Combined With a Lateral Flow Strip

Author(s):

Lei Wang,Yan Wang,Fang Wang,Mengdi Zhao,Xuzhu Gao,Huimin Chen,Na Li,Qing Zhu,Lipin Liu,Wenjun Zhu,Xia Liu,Yujiao Chen,Ping Zhou,Yingzhi Lu,Kun Wang,Weiguo Zhao,Wei Liang

Journal:

Frontiers in cellular and infection microbiology

Year:

2022

Abstract:

Cryptococcus neoformans (C. neoformans)/C. gattii can easily invade the human central nervous system and cause cryptococcal meningitis (CM). The clinical fatality rate of these fungi is extremely high and causes more than 180,000 deaths worldwide every year. At present, the common clinical identification methods of these fungi are traditional culture methods and Indian ink staining. In addition, enzyme-linked immunosorbent assay (ELISAs), polymerase chain reaction (PCR), real-time quantitative PCR detecting system (qPCR), mass spectrometry, and metagenomic next-generation sequencing (mNGS) have also been applied to detect these fungus. Due to the rapid progress of meningitis caused by C. neoformans/C. gattii infection, there is a desperate need for fast, sensitive, and on-site detection methods to meet the clinical diagnosis. Recombinase polymerase amplification (RPA) is a promising isothermal amplification technique that can compensate for the shortcomings of the above techniques, featuring short reaction time, high specificity, and high sensitivity, thus meeting the demand for in-field detection of C.neoformans/C. gattii. In our study, RPA- lateral flow strip (LFS) was used to amplify the capsule-associated gene, CAP64, of C. neoformans/C. gattii, and the primer-probe design was optimized by introducing base mismatches to obtain a specific and sensitive primer-probe combination for clinical testing, and specificity of the detection system was determined for 26 common clinical pathogens. This system was developed to obtain results in 20 min at an isothermal temperature of 37°C with a lower limit of detection as low as 10 CFU/μL or 1 fg/μL. A total of 487 clinical samples collected from multicenter multiplexes were tested to evaluate the detection performance of the RPA-LFS system, which revealed that the system could specifically detect C. neoformans/C. gattii, meeting the need for rapid, specific, and sensitive detection.