RPB0576

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
E. granulosus Echinococcus granulosus,Echinococcus granulosus G1 strain,Echinococcus granulosus G2 strain,Echinococcus granulosus G3 strain,Echinococcus granulosus Tasmanian sheep strain,Echinococcus granulosus buffalo strain,Echinococcus granulosus s. s.,Echinococcus granulosus sensu stricto,Echinococcus granulosus sheep strain 6210 Cyclophyllidea Taeniidae Echinococcus Echinococcus granulosus Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F1 ACACCACGCATGAGGATTACTGACTTGAACG 31 \ 48.39  63.7 9513.25 \
New-R1 CCACTGGTAAGTTAAATGCTTTTCCGGATGGG 32 \ 46.88  62.73 9870.46  \

Gene Description

Target Gene GenBank ID
EgG1 Hae III DQ157697

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
This novel assay is primarily used to diagnose the definitive host of E. granulosus. Further validation using a larger set of clinical fecal samples is warranted, along with additional exploration of more effective approaches for nucleic acid release. RPA\CRISPR\Cas12a \ \ 37 °C CRISPR\Cas12a 10 copies \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Optimization of CRISPR\Cas12a detection assay and its application in the detection of Echinococcus granulosus Fuqiang Huang,Xin Li,Yule Zhou,Wenqiang Tang,Zhisheng Dang,Jun Kui,Chunxia Zhang,Xu Zhang Veterinary parasitology 39089176 10.1016/j.vetpar.2024.110276

Optimization of CRISPR\Cas12a detection assay and its application in the detection of Echinococcus granulosus

Author(s):

Fuqiang Huang,Xin Li,Yule Zhou,Wenqiang Tang,Zhisheng Dang,Jun Kui,Chunxia Zhang,Xu Zhang

Journal:

Veterinary parasitology

Year:

2024

Abstract:

Cystic echinococcosis, resulting from infection with Echinococcus granulosus, poses a significant challenge as a neglected tropical disease owing to the lack of any known effective treatment. Primarily affecting under-resourced, remote, and conflict-ridden regions, the disease is compounded by the limitations of current detection techniques, such as microscopy, physical imaging, ELISA, and qPCR, which are unsuitable for application in these areas. The emergence of CRISPR/Cas12a as a promising tool for nucleic acid detection, characterized by its unparalleled specificity, heightened sensitivity, and rapid detection time, offers a potential solution. In this study, we present a one-pot CRISPR/Cas12a detection method for E. granulosus (genotype G1, sheep strain) integrating recombinase polymerase amplification (RPA) with suboptimal protospacer adjacent motif (PAM) and structured CRISPR RNA (crRNA) to enhance reaction efficiency. The evaluation of the assay's performance using hydatid cyst spiked dog feces and the examination of 62 dog fecal samples collected from various regions of Western China demonstrate its efficacy. The assay permits visual observation of test results about 15 minutes under blue light and displays superior portability and reaction speed relative to qPCR, achieving a sensitivity level of 10 copies of standard plasmids of the target gene. Analytic specificity was verified against four tapeworm species (E. multilocularis, H. taeniaeformis, M. benedeni, and D. caninum) and two other helminths (T. canis and F. hepatica), with negative results also noted for Mesocestoides sp. This study presents a rapid, sensitive, and time-efficient DNA detection method for E. granulosus of hydatid cyst spiked and clinical dog feces, potential serving as an alternative tool for field detection. This novel assay is primarily used to diagnose the definitive host of E. granulosus. Further validation using a larger set of clinical fecal samples is warranted, along with additional exploration of more effective approaches for nucleic acid release.