RPB0575

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Toxoplasma gondii Toxoplasma gondii 5811 Eucoccidiorida Sarcocystidae Toxoplasma Toxoplasma gondii Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
B1-F8 GTGAAACAATAGAGAGTACTGGAACGTCGCCGC 33 \ 51.52  65.3 10220.71 \
B1-R8 GCATGGTTTGCACTTTTGTGGTTTAGCCTCTCG 33 \ 48.48  64.94 10123.59 \

Gene Description

Target Gene GenBank ID
B1 gene AF179871.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
The RPA-CRISPR\Cas12a-LFA is rapid, sensitive, and accurate for the early diagnosis of T. gondii, showing promise for on-site surveillance. RPA-CRISPR\Cas12a-LFA Primer Premier 5 20 min 37 °C CRISPR\Cas12a-LFA 31 copies/μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 RPA-CRISPR\Cas12a-LFA combined with a digital visualization instrument to detect Toxoplasma gondii in stray dogs and cats in Zhejiang province, China RPA-CRISPR\Cas12a-LFA Hao Sun,Jiyuan Fan,Hongkun Chu,Yafan Gao,Jiawen Fang,Qinli Wu,Haojie Ding,Xunhui Zhuo,QingMing Kong,HangJun Lv,Bin Zheng,Shaohong Lu Microbiology spectrum 38809001 10.1128/spectrum.03998-23

RPA-CRISPR\Cas12a-LFA combined with a digital visualization instrument to detect Toxoplasma gondii in stray dogs and cats in Zhejiang province, China RPA-CRISPR\Cas12a-LFA

Author(s):

Hao Sun,Jiyuan Fan,Hongkun Chu,Yafan Gao,Jiawen Fang,Qinli Wu,Haojie Ding,Xunhui Zhuo,QingMing Kong,HangJun Lv,Bin Zheng,Shaohong Lu

Journal:

Microbiology spectrum

Year:

2024

Abstract:

Toxoplasma gondii, which causes toxoplasmosis, is prevalent in warm-blooded animals, such as cats, dogs, and humans. T. gondii causes economic losses to livestock production and represents a potential risk to public health. Dogs and cats are common hosts in the epidemiology of toxoplasmosis. The current molecular diagnostic tools for T. gondii infection require high technical skills, a laboratory environment, and complex instruments. Herein, we developed a recombinase polymerase amplification (RPA)-clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 12a (Cas12a) assay to detect T. gondii. The lowest limit of detection of the assay was 31 copies/μL for the T. gondii B1 gene. In addition, we established a visual RPA-CRISPR/Cas12a lateral flow band assay (RPA-CRISPR/Cas12a-LFA) combined with a digital visualization instrument, which minimized the problem of false-negative results for weakly positive samples and avoided misinterpretation of the results by the naked eye, making the LFA assay results more accurate. The assay established in this study could identify T. gondii within 55 min with high accuracy and sensitivity, without cross-reaction with other tested parasites. The developed assay was validated by establishing a mouse model of toxoplasmosis. Finally, the developed assay was used to investigate the prevalence of T. gondii in stray cats and dogs in Zhejiang province, Eastern China. The positive rates of T. gondii infection in stray cats and dogs were 8.0% and 4.0%, respectively. In conclusion, the RPA-CRISPR/Cas12a-LFA is rapid, sensitive, and accurate for the early diagnosis of T. gondii, showing promise for on-site surveillance. Importance:Toxoplasma gondii is a virulent pathogen that puts millions of infected people at risk of chronic disease reactivation. Hosts of T. gondii are distributed worldwide, and cats and dogs are common hosts of T. gondii. Therefore, rapid diagnosis of early T. gondii infection and investigation of its prevalence in stray dogs and cats are essential. Here, we established a visual recombinase polymerase amplification-clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 12a-assay combined with a lateral flow band assay and a digital visualization instrument. Detailed analyses found that the assay could be used for the early diagnosis of T. gondii without false-negative results. Moreover, we detected the prevalence of T. gondii in stray cats and dogs in Zhejiang province, China. Our developed assay provides technical support for the early diagnosis of T. gondii and could be applied in prevalence surveys of T. gondii in stray dogs and cats.