RPB0573

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Toxoplasma gondii Toxoplasma gondii 5811 Eucoccidiorida Sarcocystidae Toxoplasma Toxoplasma gondii Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
B1-L3 F1 AAGTTCCGGTCGAGAGGCTAAACCACAA 28 \ 50.00  63.66 8615.68 \
B1-L3 R1 GCATGATTCTGCGTGGTGGGCTCGTTGAT 29 \ 55.17  67.13 8986.85  \

Gene Description

Target Gene GenBank ID
B1 gene AF179871

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
This study established a rapid, sensitive, and time-saving DNA detection method for T. gondii that has the potential to be an alternative tool for T. gondii detection in the field. RPA\CRISPR\Cas12a \ 30 min 37 °C CRISPR\Cas12a 1 tachyzoite per reaction \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 CRISPR\Cas12a combined with RPA for detection of T. gondii in mouse whole blood Xiaofeng Wang,Miao Cheng,Shuqi Yang,Chen Xing,Qian Li,Yating Zhu,Yongsheng Ji,Yinan Du Parasites & vectors 37518013 10.1186/s13071-023-05868-0

CRISPR\Cas12a combined with RPA for detection of T. gondii in mouse whole blood

Author(s):

Xiaofeng Wang,Miao Cheng,Shuqi Yang,Chen Xing,Qian Li,Yating Zhu,Yongsheng Ji,Yinan Du

Journal:

Parasites & vectors

Year:

2023

Abstract:

Background: Toxoplasma gondii is an opportunistic protozoan that is ubiquitous in humans and animals. It can invade any human organ and cause severe diseases, including toxoplasma ophthalmopathy, meningoencephalitis, and liver necrosis. Porcine toxoplasmosis is prevalent in China. CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and Cas (CRISPR-Associated Protein) systems are widely used for gene editing and pathogen detection. CRISPR-based diagnostics are molecular assays that have been developed to detect parasites with high sensitivity and specificity. Methods: This study aimed to establish a combined CRISPR/Cas12a and RPA rapid detection method for T. gondii by targeting the B1 gene and 529 bp repeat element (529 RE). The detection results could be visualized by the fluorescence or lateral flow strips (LFS). The sensitivity and specificity of the method were evaluated, and T. gondii-infected mouse blood was used for detection. Results: The results indicated that the established method for T. gondii detection was satisfactory, with a detection limit of 1.5 cp/μl for the two loci. Moreover, the B1 gene could detect 1 tachyzoite per reaction, and the 529 RE could detect 0.1 tachyzoite per reaction, consistently with the highly sensitive nested polymerase chain reaction (PCR) results. The method was suitable for strains, including RH, and did not cross-react with other protozoa DNA with similar habits. The T. gondii-infected mouse blood samples were all positive for T. gondii at 1, 3, and 5 days post infection (dpi). Conclusions: This study established a rapid, sensitive, and time-saving DNA detection method for T. gondii that has the potential to be an alternative tool for T. gondii detection in the field.