RPB0572

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Toxoplasma gondii Toxoplasma gondii 5811 Eucoccidiorida Sarcocystidae Toxoplasma Toxoplasma gondii Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
529-RPA-F3 CTCCCTCGCCCTCTTCTCCACTCTTCAATTC 31 \ 54.84 65.53 9180 \
RE 529-RPA-R biotin-AGCGACGAGAGTCGGAGAGGGAGAAGATGT 33 \ 55.06 67.5 10379.88 \

Gene Description

Target Gene GenBank ID
RE 529-bp AF487550.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
This RPA-CRISPR\Cas9 method provides an alternative to conventional molecular tools used in the clinical diagnosis of Toxoplasma infection in cats and other animals. RPA-CRISPR\Cas9 \ 30 min 37 °C CRISPR\Cas9 10 plasmid copies/μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 RPA-CRISPR\Cas9-based method for the detection of Toxoplasma gondii: A proof of concept Mengchen Wu,Haiyan Wu,Xueqiu Chen,Fei Wu,Guangxu Ma,Aifang Du,Yi Yang Veterinary parasitology 38232511 10.1016/j.vetpar.2024.110115

RPA-CRISPR\Cas9-based method for the detection of Toxoplasma gondii: A proof of concept

Author(s):

Mengchen Wu,Haiyan Wu,Xueqiu Chen,Fei Wu,Guangxu Ma,Aifang Du,Yi Yang

Journal:

Veterinary parasitology

Year:

2024

Abstract:

Toxoplasma gondii is a widespread and specialized intracellular protozoan pathogen that affects one third of the world' s population, posing a great threat to public health. As the definitive host, cats excrete oocysts and play a crucial role in the transmission of toxoplasmosis. The current diagnostic tools usually require bulky equipment and expertize, which hinders the efficient diagnosis and intervention of Toxoplasma infection in cats. In this study, we combined (RPA) with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 technique to establish an easier method for the detection of T. gondii oocysts in cat fecal samples. The sensitivity, specificity, and practicability of the established RPA-CRISPR/Cas9 method were evaluated using a lateral flow strip, with the limitation of detection determined at 10 plasmid copies/μL (corresponding to about one oocyst), cross reactivity to none of Giardia lamblia, Cryptosporidium sp., Microsporidium biberi and Blastocystis hominis that also commonly found in cats, and comparable performance in detecting T. gondii in clinical samples to conventional PCR amplification. This RPA-CRISPR/Cas9 method provides an alternative to conventional molecular tools used in the clinical diagnosis of Toxoplasma infection in cats and other animals.