RPB0571

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Toxoplasma gondii Toxoplasma gondii 5811 Eucoccidiorida Sarcocystidae Toxoplasma Toxoplasma gondii Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F4 GAGCCACAGAAGGGACAGAAGTCG 24 \ 58.33 62.27 7469.93 \
R4 CCTCCAGGAAAAGCAGCCAAGCCG 24 \ 62.5 66.05 7325.83 \

Gene Description

Target Gene GenBank ID
529 bp-RE AF146527.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
RAA-Cas12a-Tg system provided a rapid, sensitive and easily operable method for point-of-care detection of T. gondii oocysts in soil, which will facilitate the control of T. gondii infection in humans and animals. RAA-Cas12a-Tg Premier 5 20 min 39 °C Cas12a-Tg 1 fM \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2021 RAA-Cas12a-Tg: A Nucleic Acid Detection System for Toxoplasma gondii Based on CRISPR-Cas12a Combined with Recombinase-Aided Amplification (RAA) Qiao-Ni Ma,Meng Wang,Lai-Bao Zheng,Zi-Qin Lin,Muhammad Ehsan,Xing-Xing Xiao,Xing-Quan Zhu Microorganisms 34442722 10.3390/microorganisms9081644

RAA-Cas12a-Tg: A Nucleic Acid Detection System for Toxoplasma gondii Based on CRISPR-Cas12a Combined with Recombinase-Aided Amplification (RAA)

Author(s):

Qiao-Ni Ma,Meng Wang,Lai-Bao Zheng,Zi-Qin Lin,Muhammad Ehsan,Xing-Xing Xiao,Xing-Quan Zhu

Journal:

Microorganisms

Year:

2021

Abstract:

Toxoplasmosis, caused by the intracellular protozoon Toxoplasma gondii, is a significant parasitic zoonosis with a world-wide distribution. As a main transmission route, human infection can be acquired by the ingestion of T. gondii oocysts from the environment (e.g., soil, water, fruits and vegetables). Regarding the detection of T. gondii oocysts in environmental samples, the development of a time-saving, cost-effective and highly sensitive technique is crucial for the surveillance, prevention and control of toxoplasmosis. In this study, we developed a new method by combining recombinase-aided amplification (RAA) with CRISPR-Cas12a, designated as the RAA-Cas12a-Tg system. Here, we compared this system targeting the 529 bp repeat element (529 bp-RE) with the routine PCR targeting both 529 bp-RE and ITS-1 gene, respectively, to assess its ability to detect T. gondii oocysts in soil samples. Our results indicated that the 529 bp RE-based RAA-Cas12a-Tg system was able to detect T. gondii successfully in nearly an hour at body temperature and was more sensitive than the routine PCR assay. The sensitivity of this system reached as low as 1 fM with high specificity. Thus, RAA-Cas12a-Tg system provided a rapid, sensitive and easily operable method for point-of-care detection of T. gondii oocysts in soil, which will facilitate the control of T. gondii infection in humans and animals.