RPB0568

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Toxoplasma gondii Toxoplasma gondii 5811 Eucoccidiorida Sarcocystidae Toxoplasma Toxoplasma gondii Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F AGACGAGACGACGCTTTCC 19 \ 57.89 57.61 5797.84 \
R GCATCTGGATTCCTCTCCTACC 22 \ 54.55 57.21 6597.34 \

Gene Description

Target Gene GenBank ID
529 bp repeat sequences AF146527

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
In summary, the rapid visual detection of T. gondii by combining recombinase polymerase amplification and lateral flow dipstick coupled with a CRISPR-Cas13a fluorescence assay that we have established could be superior to other molecular diagnostic tools in point-of-need application. This protocol is simple in operation, easier in visualization of the reaction results, and highly specific and sensitive, as well as promising for on-site testing of T. gondii infection in clinical settings. RAA-Cas13a-LFD \ 40 min 37 °C Cas13a-LFD 1 × 10-6ng/μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 A novel rapid visual detection assay for Toxoplasma gondii combining recombinase-aided amplification and lateral flow dipstick coupled with CRISPR-Cas13a fluorescence (RAA-Cas13a-LFD) Jinhong Zhao,Yuanyuan Li,Qiqi Xue,Zhiwei Zhu,Minghui Zou,Fang Fang Parasite (Paris, France) 35420541 10.1051/parasite/2022021

A novel rapid visual detection assay for Toxoplasma gondii combining recombinase-aided amplification and lateral flow dipstick coupled with CRISPR-Cas13a fluorescence (RAA-Cas13a-LFD)

Author(s):

Jinhong Zhao,Yuanyuan Li,Qiqi Xue,Zhiwei Zhu,Minghui Zou,Fang Fang

Journal:

Parasite (Paris, France)

Year:

2022

Abstract:

Toxoplasmosis, a parasitic disease resulting from Toxoplasma gondii infection, remains prevalent worldwide, and causes great harm to immunodepressed patients, pregnant women and newborns. Although various molecular approaches to detect T. gondii infection are available, they are either costly or technically complex. This study aimed at developing a rapid visual detection assay using recombinase-aided amplification (RAA) and lateral flow dipstick (LFD) coupled with CRISPR-Cas13a fluorescence (RAA-Cas13a-LFD) to detect T. gondii. The RAA-Cas13a-LFD assay was performed in an incubator block at 37 °C within 2 h, and the amplification results were visualized and determined through LFD by the naked eye. The detection limit was 1 × 10-6 ng/μL by our developed RAA-Cas13a-LFD protocol, 100-fold higher than that by qPCR assay (1 × 10-8 ng/μL). No cross-reaction occurred either with the DNA of human blood or Ascaris lumbricoides, Digramma interrupta, Entamoeba coli, Fasciola gigantica, Plasmodium vivax, Schistosoma japonicum, Taenia solium, and Trichinella spiralis, and the positive rate by RAA-Cas13a-LFD assay was identical to that by qPCR assay (1.50% vs. 1.50%) in detecting T. gondii infection in the unknown blood samples obtained from clinical settings. Our findings demonstrate that this RAA-Cas13a-LFD assay is not only rapid, sensitive, and specific and allows direct visualization by the naked eye, but also eliminates sophisticated and costly equipment. More importantly, this technique can be applied to on-site surveillance of T. gondii.