RPB0567

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Plasmodium falciparum  Plasmodium falciparum,Plasmodium (Laverania) falciparum 5833 Haemosporida Plasmodiidae Plasmodium Plasmodium falciparum Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F3 CGATAATGATAACGATTTATATATGGAATAT 31 \ 22.58 48 9580.34 \
R1 TTATTGTATATATTATTTTCCCAATGATTG 30 \ 20 46.79 9166.04 \

Gene Description

Target Gene GenBank ID
Pfexo gene PF3D7_1362500

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Importantly, we provide more practical detection methods for the early detection of resistance gene mutations related to antimalarial drug resistance, which will contribute to the global malaria elimination program. RAA‒CRISPR\Cas12a \ 30 min 39 °C CRISPR\Cas12a 10^3 copies/μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Rapid detection of mutations in the suspected piperaquine resistance gene E415G-exo in Plasmodium falciparum exonuclease via AS‒PCR and RAA with CRISPR\Cas12a Huiyin Zhu,Daiqian Zhu,Yuting Li,Yun Li,Xiaonan Song,Jinyu Mo,Long Liu,Zhixin Liu,Siqi Wang,Yi Yao,He Yan,Kai Wu,Wei Wang,Jianhai Yin,Min Lin,Jian Li International journal for parasitology. Drugs and drug resistance 39476461 10.1016/j.ijpddr.2024.100568

Rapid detection of mutations in the suspected piperaquine resistance gene E415G-exo in Plasmodium falciparum exonuclease via AS‒PCR and RAA with CRISPR\Cas12a

Author(s):

Huiyin Zhu,Daiqian Zhu,Yuting Li,Yun Li,Xiaonan Song,Jinyu Mo,Long Liu,Zhixin Liu,Siqi Wang,Yi Yao,He Yan,Kai Wu,Wei Wang,Jianhai Yin,Min Lin,Jian Li

Journal:

International journal for parasitology. Drugs and drug resistance

Year:

2024

Abstract:

Malaria remains a major public health concern. The rapid spread of resistance to antimalarial drugs is a major challenge for malaria eradication. Timely and accurate molecular monitoring based on practical detection methods is a critical step toward malaria control and elimination. In this study, two rapid detection techniques, allele-specific PCR (AS‒PCR) and recombinase-aided amplification (RAA) combined with CRISPR/Cas12a, were established, optimized and assessed to detect single nucleotide polymorphisms in the Plasmodium falciparum exonuclease (Pfexo) gene related to suspected piperaquine resistance. Moreover, phosphorothioate and artificial mismatches were introduced into the allele-specific primers for AS‒PCR, and crRNA-mismatched bases were introduced into the RAA‒CRISPR/Cas12a assay because crRNAs designed according to conventional rules fail to discriminate genotypes. As a result, the detection limits of the AS‒PCR and RAA‒CRISPR/Cas12a assays were 104 copies/μL and 103 copies/μL, respectively. The detection threshold for dried blood spots was 100‒150 parasites/μL, with no cross-reactivity against other genotypes. The average cost of AS‒PCR is approximately $1 per test and takes 2-3 h, whereas that of the RAA‒CRISPR/Cas12a system is approximately $7 per test and takes 1 h or less. Therefore, we provide more options for testing single nucleotide polymorphisms in the Pfexo gene, considering economic conditions and the availability of instruments, equipment, and reagents, which can contribute to the molecular monitoring of antimalarial resistance.