RPB0566

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Plasmodium falciparum  Plasmodium falciparum,Plasmodium (Laverania) falciparum 5833 Haemosporida Plasmodiidae Plasmodium Plasmodium falciparum Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
primer18S-F ATACCGTCGTAATCTTAACCATAAACTATACC 32 \ 34.38 55.03 9695.4 \
primer18S-R TTATCGGAATTAACCAGACAAATCATATTCAC 32 \ 31.25 54.34 9759.45 \
primer18S-CY5-R CY5-TTATCGGAATTAACCAGACAAATCATATTCAC 34 \ 33.82 55.9 10345.33 \

Gene Description

Target Gene GenBank ID
18S rRNA gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
The proposed SiSA-chip assay is a promising method for pathogen identification and infectious disease diagnosis, as well as SNP genotyping. RPA-SiSA-chip assay Primer-BLAST tool of NCBI 20 min 39 °C SiSA-chip assay 6 copies/reaction \ 1% m\wt

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2022 Rapid, Highly Sensitive, and Label-Free Pathogen Assay System Using a Solid-Phase Self-Interference Recombinase Polymerase Amplification Chip and Hyperspectral Interferometry Xiangyu Jin,Rongxin Fu,Wenli Du,Xiaohui Shan,Zeyin Mao,Anni Deng,Xue Lin,Ya Su,Han Yang,Wenqi Lv,Hao Zhong,Guoliang Huang Analytical chemistry 35107980 10.1021/acs.analchem.1c04858

Rapid, Highly Sensitive, and Label-Free Pathogen Assay System Using a Solid-Phase Self-Interference Recombinase Polymerase Amplification Chip and Hyperspectral Interferometry

Author(s):

Xiangyu Jin,Rongxin Fu,Wenli Du,Xiaohui Shan,Zeyin Mao,Anni Deng,Xue Lin,Ya Su,Han Yang,Wenqi Lv,Hao Zhong,Guoliang Huang

Journal:

Analytical chemistry

Year:

2022

Abstract:

Recombinase polymerase amplification (RPA) is a useful pathogen identification method. Several label-free detection methods for RPA amplicons have been developed in recent years. However, these methods still lack sensitivity, specificity, efficiency, or simplicity. In this study, we propose a rapid, highly sensitive, and label-free pathogen assay system based on a solid-phase self-interference RPA chip (SiSA-chip) and hyperspectral interferometry. The SiSA-chips amplify and capture RPA amplicons on the chips, rather than irrelevant amplicons such as primer dimers, and the SiSA-chips are then analysed by hyperspectral interferometry. Optical length increases of SiSA-chips are used to demonstrate RPA detection results, with a limit of detection of 1.90 nm. This assay system can detect as few as six copies of the target 18S rRNA gene of Plasmodium falciparum within 20 min, with a good linear relationship between the detection results and the concentration of target genes (R2 = 0.9903). Single nucleotide polymorphism (SNP) genotyping of the dhfr gene of Plasmodium falciparum is also possible using the SiSA-chip, with as little as 1% of mutant gene distinguished from wild-type loci (m/wt). This system offers a high-efficiency (20 min), high-sensitivity (6 copies/reaction), high-specificity (1% m/wt), and low-cost (∼1/50 of fluorescence assays for RPA) diagnosis method for pathogen DNA identification. Therefore, this system is promising for fast identification of pathogens to help diagnose infectious diseases, including SNP genotyping.