RPB0565

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Plasmodium falciparum  Plasmodium falciparum,Plasmodium (Laverania) falciparum 5833 Haemosporida Plasmodiidae Plasmodium Plasmodium falciparum Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F2 GTTCTTGTCTTGGTAAATGTGCTCATGTG 29 \ 41.38 57.96 8935.84 \
R1 GGTAGGTGGAATAGATTCTCTTATAAATCC 30 \ 36.67 53.87 9260.09 \

Gene Description

Target Gene GenBank ID
Pfcrt gene PF3D7_0709000

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
This study established an RPA-PfAgo platform for genotyping the key mutation Pfcrt-CVMNK\CVIET of CQR. This approach has the characteristics of a short operation time, low device dependence, and good match to the POCT strategy, suggesting that the platform can be easily applied locally or on site. RPA-PfAgo Primer-BLAST 20 min 37 °C Pyrococcus furiosus argonaute (PfAgo) protein 1.8 × 104 copies/μL 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Rapid and supersensitive allele detection of Plasmodium falciparum chloroquine resistance via a Pyrococcus furiosus argonaute-triggered dual-signal biosensing platform Liying Chen,Wencheng Chen,Huagui Wei,Wenai Lin,Cheng Zhang,Hongfei Hu,Chunfang Wang,Jiangtao Chen,Xueyan Liang,Daiqian Zhu,Junli Wang,Zongyun Lin,Yuxia Wei,Jian Li,Min Lin Parasites & vectors 39582041 10.1186/s13071-024-06575-0

Rapid and supersensitive allele detection of Plasmodium falciparum chloroquine resistance via a Pyrococcus furiosus argonaute-triggered dual-signal biosensing platform

Author(s):

Liying Chen,Wencheng Chen,Huagui Wei,Wenai Lin,Cheng Zhang,Hongfei Hu,Chunfang Wang,Jiangtao Chen,Xueyan Liang,Daiqian Zhu,Junli Wang,Zongyun Lin,Yuxia Wei,Jian Li,Min Lin

Journal:

Parasites & vectors

Year:

2024

Abstract:

Background: Malaria remains a serious public health problem worldwide, particularly in Africa. Resistance to antimalarial drugs is an essential issue for malaria control and elimination. Currently, polymerase chain reaction (PCR) combined with Sanger sequencing is regarded as the gold standard for mutation detection. However, this method fails to meet the requirements of point-of-care testing (POCT) because of its time-consuming, expensive instruments and professional dependence. To support this strategy, we developed a novel diagnostic platform that combines recombinase polymerase amplification (RPA) with the Pyrococcus furiosus argonaute (PfAgo) protein and was designed to detect gene mutations related to antimalarial drug resistance. The Pfcrt haplotypes CVMNK and CVIET of chloroquine resistance (CQR) were used as examples and were assessed in this study. Methods: By meticulously designing strategies, RPA primers, guide DNAs, and probes were screened, the reaction was optimized, and the resulting parameters were employed to ascertain the genotype of Pfcrt. The recombinant plasmids pUC57/Pfcrt-CVIET and pUC57/Pfcrt-CVMNK were constructed and diluted for sensitivity detection. The pUC57/Pfcrt-CVIET plasmid mixture was added to the pUC57/Pfcrt-CVMNK plasmid mixture in different additions to configure several specific proportions of mixed plasmid mixtures. The RPA-PfAgo platform was used, and the mixed plasmid was detected simultaneously via nest-PCR (nPCR) and Sanger sequencing. The platform was then evaluated on 85 clinical samples and compared with Sanger sequencing. Results: The entire process achieves the key mutation Pfcrt-CVMNK/CVIET genotype identification of CQR within 90 min. The platform achieved 1.8 × 104 copies/μL sensitivity and could detect as little as 3% CVIET in mixed plasmids, which is a higher sensitivity than that of Sanger sequencing (5%). Notably, the platform shows 100% concordance with the gold standard method when 85 clinical samples are tested. The sensitivity and specificity were 100% for the 85 clinical samples. Conclusions: This study established an RPA-PfAgo platform for genotyping the key mutation Pfcrt-CVMNK/CVIET of CQR. This method can rapidly produce reliable results and avoid the disadvantages of nPCR with sequencing. This approach has the characteristics of a short operation time, low device dependence, and a good match to the POCT strategy, suggesting that the platform can be easily applied locally or on site.