RPB0564

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Plasmodium falciparum  Plasmodium falciparum,Plasmodium (Laverania) falciparum 5833 Haemosporida Plasmodiidae Plasmodium Plasmodium falciparum Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
Pfal28S_F1 GGAGTAGAAACTGAAATATGTTTTTACGACAG 32 420 nM 34.38 55.06 9935.55 \
Pfal28S_R1_Bio Biotin-GAAATTGGGAGAAAGATAAGAAACAAGTTTC 31 420 nM 32.26 53.95 9673.4 \
Pfal28S_P FAM-GTTGTTTTACTTATCCATTTATAGGGAAAT [dSpacer]TATTATGCTTTATCCTTCG-SpC3 49 120 nM 28.57 58.12 15012.81 \

Gene Description

Target Gene GenBank ID
rRNA genes (28S) \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
It is particularly useful in settings where uRT-qPCR is difficult to implement. RT-RPA \ 20 min 40°C LF 64 parasites\ml \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2020 Recombinase Polymerase Amplification and Lateral Flow Assay for Ultrasensitive Detection of Low-Density Plasmodium falciparum Infection from Controlled Human Malaria Infection Studies and Naturally Acquired Infections Albert Lalremruata,The Trong Nguyen,Matthew B B McCall,Ghyslain Mombo-Ngoma,Selidji T Agnandji,Ayôla A Adegnika,Bertrand Lell,Michael Ramharter,Stephen L Hoffman,Peter G Kremsner,Benjamin Mordmüller Journal of clinical microbiology 32102854 10.1128/JCM.01879-19

Recombinase Polymerase Amplification and Lateral Flow Assay for Ultrasensitive Detection of Low-Density Plasmodium falciparum Infection from Controlled Human Malaria Infection Studies and Naturally Acquired Infections

Author(s):

Albert Lalremruata,The Trong Nguyen,Matthew B B McCall,Ghyslain Mombo-Ngoma,Selidji T Agnandji,Ayôla A Adegnika,Bertrand Lell,Michael Ramharter,Stephen L Hoffman,Peter G Kremsner,Benjamin Mordmüller

Journal:

Journal of clinical microbiology

Year:

2020

Abstract:

Microscopy and rapid diagnostic tests (RDTs) are the main diagnostic tools for malaria but fail to detect low-density parasitemias that are important for maintaining malaria transmission. To complement existing diagnostic methods, an isothermal reverse transcription-recombinase polymerase amplification and lateral flow assay (RT-RPA) was developed. We compared the performance with that of ultrasensitive reverse transcription-quantitative PCR (uRT-qPCR) using nucleic acid extracts from blood samples (n = 114) obtained after standardized controlled human malaria infection (CHMI) with Plasmodium falciparum sporozoites. As a preliminary investigation, we also sampled asymptomatic individuals (n = 28) in an area of malaria endemicity (Lambaréné, Gabon) to validate RT-RPA and assess its performance with unprocessed blood samples (dbRT-RPA). In 114 samples analyzed from CHMI trials, the positive percent agreement to uRT-qPCR was 90% (95% confidence interval [CI], 80 to 96). The negative percent agreement was 100% (95% CI, 92 to 100). The lower limit of detection was 64 parasites/ml. In Gabon, RT-RPA was 100% accurate with asymptomatic volunteers (n = 28), while simplified dbRT-RPA showed 89% accuracy. In a subgroup analysis, RT-RPA detected 9/10 RT-qPCR-positive samples, while loop-mediated isothermal amplification (LAMP) detected 2/10. RT-RPA is a reliable diagnostic test for asymptomatic low-density infections. It is particularly useful in settings where uRT-qPCR is difficult to implement.