RPB0563

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Plasmodium falciparum  Plasmodium falciparum,Plasmodium (Laverania) falciparum 5833 Haemosporida Plasmodiidae Plasmodium Plasmodium falciparum Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
Pf-F3 GTGTTCATAACAGACGGGTAGTCATGATTGAGTTC 35 \ 42.86 61.16 10841.1 \
Pf-R3 ACATCTGAATACGAATGCCCCCAAAGCTACTCCTA 35 \ 45.71 64.56 10612.98 \

Gene Description

Target Gene GenBank ID
18S rRNA gene NC_004326.2

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
The fluorescent RAA\CRISPR-Cas12a system is rapid, sensitive and specific for detection of P. falciparum, which shows promising value for rapid detection and risk monitoring of P. falciparum. fluorescent RAA\CRISPR-Cas12a Primer Premier 5.0,Oligo 7.0 40 min 37 °C CRISPR\Cas12a 1 copy/μL(P. falciparum strain 3D7) \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Establishment and preliminary evaluation of a fluorescent recombinase-aid⁃ ed amplification\CRISPR-Cas12a system for rapid detection of Plasmodium falciparum W Huang,H Wei,C Wang,J Wang,L Chen,W Chen,Y Liu,Y Zheng,M Lin Zhongguo xue xi chong bing fang zhi za zhi = Chinese journal of schistosomiasis control 36974013 10.16250/j.32.1374.2022240

Establishment and preliminary evaluation of a fluorescent recombinase-aid⁃ ed amplification\CRISPR-Cas12a system for rapid detection of Plasmodium falciparum

Author(s):

W Huang,H Wei,C Wang,J Wang,L Chen,W Chen,Y Liu,Y Zheng,M Lin

Journal:

Zhongguo xue xi chong bing fang zhi za zhi = Chinese journal of schistosomiasis control

Year:

2023

Abstract:

Objective: To establish a fluorescent assay for rapid detection of Plasmodium falciparum based on recombinaseaided amplification (RAA) and CRISPR-Cas12a system,and to preliminarily evaluate the diagnostic efficiency of this system. Methods: The 18S ribosomal RNA (rRNA) gene of P. falciparum was selected as the target sequence, and three pairs of RAA primers and CRISPR-derived RNA (crRNA) were designed and synthesized. The optimal combination of RAA primers and crRNA was screened and the reaction conditions of the system were optimized to create a fluorescent RAA/CRISPR-Cas12a system. The plasmid containing 18S rRNA gene of the P. falciparum strain 3D7 was generated, and diluted into concentrations of 1 000, 100, 10, 1 copy/μL for the fluorescent RAA/CRISPR-Cas12a assay, and its sensitivity was evaluated. The genomic DNA from P. vivax, P. malariae, P. ovum, hepatitis B virus, human immunodeficiency virus and Treponema pallidum was employed as templates for the fluorescent RAA/CRISPR-Cas12a assay, and its specificity was evaluated. Fifty malaria clinical samples were subjected to the fluorescent RAA/CRISPR-Cas12a assay and nested PCR assay, and the consistency between two assays was compared. In addition, P. falciparum strain 3D7 was cultured in vitro. Then, the culture was diluted into blood samples with parasite densities of 1 000, 500, 200, 50, 10 parasites/μL with healthy volunteers' O-positive red blood cells for the RAA/CRISPR-Cas12a assay, and the detection efficiency was tested. Results: The Pf-F3/Pf-R3/crRNA2 combination, 2.5 μL as the addition amount of B buffer, 40 min as the RAA reaction time, 37 °C as the reaction temperature of the CRISPR-Cas12a system were employed to establish the fluorescent RAA/CRISPR-Cas12a system. Such a system was effective to detect the plasmid containing 18S rRNA gene of the P. falciparum strain 3D7 at a concentration of 1 copy/μL, and presented fluorescent signals for detection of P. falciparum, but failed to detect P. ovum, P. malariae, P. vivax, T. pallidum, hepatitis B virus or human immunodeficiency virus. The fluorescent RAA/CRISPR-Cas12a system and nested PCR assay showed completely consistent results for detection of 50 malaria clinical samples (kappa = 1.0, P < 0.001). Following 6-day in vitro culture of the P. falciparum strain 3D7, 10 mL cultures were generated and the fluorescent RAA/CRISPR-Cas12a system showed the minimal detection limit of 50 parasites/μL. Conclusions: The fluorescent RAA/CRISPR-Cas12a system is rapid, sensitive and specific for detection of P. falciparum, which shows promising value for rapid detection and risk monitoring of P. falciparum.