RPB0562

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Plasmodium falciparum  Plasmodium falciparum,Plasmodium (Laverania) falciparum 5833 Haemosporida Plasmodiidae Plasmodium Plasmodium falciparum Eukaryota

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
Pf-F4 GTGTTCATAACAGACGGGTAGTCATGATT 29 \ 41.38 58 8971.9 \
Pf-R4 ACATCTGAATACGAATGCCCCCAAAGCTA 29 \ 44.83 61.54 8823.83 \

Gene Description

Target Gene GenBank ID
18S rRNA gene M19173.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Altogether, the establishment of the RPA-CRISPR\Cas12a platform based on the 18S rRNA of Plasmodium spp., as in this comparison, provides a reliable, accurate, and rapid detection method for the identification and monitoring of Plasmodium species. As a new molecular biological method for malaria diagnosis, RPA-CRISPR\Cas12a promises to bridge the gap between rapid diagnostic needs and current technology. RPA-CRISPR\Cas12a \ 20 min 39 °C CRISPR\Cas12a 1 copy/μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Rapid and Ultrasensitive Detection of Plasmodium spp. Parasites via the RPA-CRISPR\Cas12a Platform Huagui Wei,Jian Li,Yaqun Liu,Weijia Cheng,Huiying Huang,Xueyan Liang,Weiyi Huang,Liyun Lin,Yuzhong Zheng,Weizhong Chen,Chunfang Wang,Wencheng Chen,Guidan Xu,Wujun Wei,Liying Chen,Yongmei Zeng,Zefang Lu,Shujuan Li,Zongyun Lin,Junli Wang,Min Lin ACS infectious diseases 37493514 10.1021/acsinfecdis.3c00087

Rapid and Ultrasensitive Detection of Plasmodium spp. Parasites via the RPA-CRISPR\Cas12a Platform

Author(s):

Huagui Wei,Jian Li,Yaqun Liu,Weijia Cheng,Huiying Huang,Xueyan Liang,Weiyi Huang,Liyun Lin,Yuzhong Zheng,Weizhong Chen,Chunfang Wang,Wencheng Chen,Guidan Xu,Wujun Wei,Liying Chen,Yongmei Zeng,Zefang Lu,Shujuan Li,Zongyun Lin,Junli Wang,Min Lin

Journal:

ACS infectious diseases

Year:

2023

Abstract:

Microscopic examination of thick and thin blood smears stained with Giemsa dye is considered the primary diagnostic tool for the confirmation and management of suspected clinical malaria. However, detecting gametocytes is relatively insensitive, particularly in asymptomatic individuals with low-density Plasmodium infections. To complement existing diagnostic methods, a rapid and ultrasensitive point-of-care testing (POCT) platform for malaria detection is urgently needed and necessary. A platform based on recombinase polymerase amplification (RPA) followed by CRISPR/Cas12a (referred to as RPA-CRISPR/Cas12a) was developed and optimized for the determination of Plasmodium spp. parasites, particularly Plasmodium falciparum, using a fluorescence-based assay (FBDA), lateral flow test strips (LFTS), or naked eye observation (NEO). Then, the established platform was assessed with clinical malaria isolates. Under optimal conditions, the detection threshold was 1 copy/μL for the plasmid, and the limit of detection was 3.11-7.27 parasites/μL for dried blood spots. There was no cross-reactivity against blood-borne pathogens. For the accuracies of RPA-CRISPR/Cas12a, Plasmodium spp. and P. falciparum testing were 98.68 and 94.74%, respectively. The method was consistent with nested PCR results and superior to the qPCR results. RPA-CRISPR/Cas12a is a rapid, ultrasensitive, and reliable platform for malaria diagnosis. The platform requires no or minimal instrumentation for nucleic acid amplification reactions and can be read with the naked eye. Compared with similar diagnostic methods, this platform improves the reaction speed while reducing detection requirements. Therefore, this platform has the potential to become a true POCT for malaria parasites.