| Target Pathogen | Pathogen Name | NCBI Taxonomy ID | Order | Family | Genus | Species | Pathogen type |
|---|---|---|---|---|---|---|---|
| Listeria monocytogenes | Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980),SLCC:53,"Bacterium monocytogenes","Erysipelothrix monocytogenes",Listeria sp. FDA00013359,Listeria sp. FDA00013360,Listeria sp. FDA00013361,Listeria sp. FDA00013362,Listeria sp. FDA00013363,Listeria sp. FDA00013364,Listeria sp. FDA00013365,Listeria sp. FDA00013366,Listeria sp. FDA00013367,Listeria sp. FDA00013503,Listeria sp. FDA00013504,Listeria sp. FDA00013505,Listeria sp. FDA00013506,Listeria sp. FDA00013507,Listeria sp. FDA00013508,Listeria sp. FDA00013509,Listeria sp. FDA00013510,Listeria sp. FDA00013511,Listeria sp. FDA00013512,Listeria sp. FDA00013536,Listeria sp. FDA00013537,Listeria sp. FDA00013538,Listeria sp. FDA00013539,Listeria sp. FDA00013540,Listeria sp. FDA00013541,Listeria sp. FDA00013542,Listeria sp. FDA00013543,Listeria sp. FDA00013544,Listeria sp. FDA00013545,Listeria sp. FDA00013546,Listeria sp. FDA00013547,Listeria sp. FDA00013548,Listeria sp. FDA00013549,Listeria sp. FDA00013550,Listeria sp. FDA00013551,Listeria sp. FDA00013552,Listeria sp. FDA00013553,Listeria sp. FDA00013554,Listeria sp. FDA00013555,Listeria sp. FDA00013556,Listeria sp. FDA00013557,Listeria sp. FDA00013558,Listeria sp. FDA00013559,Listeria sp. FDA00013560,Listeria sp. FDA00013561,Listeria sp. FDA00013562,Listeria sp. FDA00013563,Listeria sp. FDA00013564,Listeria sp. FDA00013565,Listeria sp. FDA00013566,Listeria sp. FDA00013567,Listeria sp. FDA00013568,Listeria sp. FDA00013570,Listeria sp. FDA00013571,Listeria sp. FDA00013572,Listeria sp. FDA00013573,Listeria sp. FDA00013574,Listeria sp. FDA00013575,Listeria sp. FDA00013576,Listeria sp. FDA00013577,Listeria sp. FDA00013578,Listeria sp. FDA00013579,Listeria sp. FDA00013607,"Listerella hepatolytica","Bacterium monocytogenes hominis","Corynebacterium parvulum","Corynebacterium infantisepticum" | 1639 | Bacillales | Listeriaceae | Listeria | Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980) | Bacteria |
| Primer Name | Sequence(5'-3') | Length(bp) | Primer Final Concentration(μM） | GC Content（%） | Predicted Melting Temperature(℃） | Molecular Weight(g/moles) | Positions in GenBank accession number |
|---|---|---|---|---|---|---|---|
| RAA-F | GTAACGTGTCAAGATATGAATCCATCAGACT | 31 | \ | 38.71 | 57.42 | 9527.28 | \ |
| RAA-R | TAATCCAATTTCCTTTCTCTGACTCTACTTG | 31 | \ | 35.48 | 55.52 | 9337.13 | \ |
| RAA-P | GCACTTGAAGCTGAAAGAATACGCCGTT[FAM-dT]G[THF]A[BHQ1-dT]AATAAATTTGTCA[3’-block] | 43 | \ | 37.21 | 63.24 | 13282.72 | \ |
| Application | Assay | Primer Designing Software | Reaction Time(min) | Assay Temperature(℃) | Readout System(s) | Limit of Detection(LoD) | Sensitivity(%) | Specificity(%) |
|---|---|---|---|---|---|---|---|---|
| Moreover, the use of constant room temperature as the reaction temperature and the single-tube detection process make this system promising for point-of-care testing. | RAA-Cas12aFDet | Oligo 7.0 software | 30 min | 37 °C | Cas12aFDet | 1.35 × 102cfu\mL | \ | \ |
| Year of Publication | Title | Author(s) | Journal | PMID | DOI | ||
|---|---|---|---|---|---|---|---|
| 2021 | Cas12aFDet: A CRISPR\Cas12a-based fluorescence platform for sensitive and specific detection of Listeria monocytogenes serotype 4c | Fan Li,Qinghua Ye,Moutong Chen,Xinran Xiang,Jumei Zhang,Rui Pang,Liang Xue,Juan Wang,Qihui Gu,Tao Lei,Xianhu Wei,Yu Ding,Qingping Wu | Analytica chimica acta | 33608071 | 10.1016/j.aca.2021.338248 | ||
Cas12aFDet: A CRISPR\Cas12a-based fluorescence platform for sensitive and specific detection of Listeria monocytogenes serotype 4cAuthor(s):Fan Li,Qinghua Ye,Moutong Chen,Xinran Xiang,Jumei Zhang,Rui Pang,Liang Xue,Juan Wang,Qihui Gu,Tao Lei,Xianhu Wei,Yu Ding,Qingping WuJournal:Analytica chimica actaYear:2021Abstract:The CRISPR/Cas12a system has displayed remarkable potential in the development of new methods for nucleic acid detection owing to the trans-cleavage activity of Cas12a. Despite the tremendous development in recent years, existing CRISPR/Cas12a-based methods have several limitations such as the time-consuming process, which takes up to 2 h, and the risk of aerosol contamination during DNA amplicon transfer. Herein, we propose a CRISPR/Cas12a-based fluorescence detection platform named "Cas12aFDet" for rapid nucleic acid detection that overcomes these limitations. By integrating PCR or recombinase-aided amplification (RAA) methods with Cas12a-mediated cleavage in a sealed reaction tube, Cas12aFDet-based detection of amplified products could be accomplished within 15 min, while avoiding amplicon contamination. The detection limits of PCR-based Cas12aFDet and RAA-based Cas12aFDet were determined to be 3.37 × 101 cfu/mL and 1.35 × 102 cfu/mL of Listeria monocytogenes serotype 4c in pure culture, respectively. Most importantly, RAA-based Cas12aFDet exhibited 0.64 aM sensitivity for DNA detection, and showed high specificity for detection of other serotypes of Listeria and non-Listeria strains. Furthermore, the feasibility of the RAA-based Cas12aFDet method was evaluated in spiked and natural samples, enabling the quantitative detection of 1.35 × 108-1.35 × 103 cfu/g fresh grass carp of the target L. monocytogenes serotype 4c, and the results obtained for 22 natural aquatic samples were highly consistent with those of the culture-based serotyping method. The established Cas12aFDet platform is expected to provide a new paradigm for the sensitive and specific detection of pathogens in food safety and clinical diagnosis.PMID:33608071
|
|||||||