RPB0557

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Listeria monocytogenes Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980),SLCC:53,"Bacterium monocytogenes","Erysipelothrix monocytogenes",Listeria sp. FDA00013359,Listeria sp. FDA00013360,Listeria sp. FDA00013361,Listeria sp. FDA00013362,Listeria sp. FDA00013363,Listeria sp. FDA00013364,Listeria sp. FDA00013365,Listeria sp. FDA00013366,Listeria sp. FDA00013367,Listeria sp. FDA00013503,Listeria sp. FDA00013504,Listeria sp. FDA00013505,Listeria sp. FDA00013506,Listeria sp. FDA00013507,Listeria sp. FDA00013508,Listeria sp. FDA00013509,Listeria sp. FDA00013510,Listeria sp. FDA00013511,Listeria sp. FDA00013512,Listeria sp. FDA00013536,Listeria sp. FDA00013537,Listeria sp. FDA00013538,Listeria sp. FDA00013539,Listeria sp. FDA00013540,Listeria sp. FDA00013541,Listeria sp. FDA00013542,Listeria sp. FDA00013543,Listeria sp. FDA00013544,Listeria sp. FDA00013545,Listeria sp. FDA00013546,Listeria sp. FDA00013547,Listeria sp. FDA00013548,Listeria sp. FDA00013549,Listeria sp. FDA00013550,Listeria sp. FDA00013551,Listeria sp. FDA00013552,Listeria sp. FDA00013553,Listeria sp. FDA00013554,Listeria sp. FDA00013555,Listeria sp. FDA00013556,Listeria sp. FDA00013557,Listeria sp. FDA00013558,Listeria sp. FDA00013559,Listeria sp. FDA00013560,Listeria sp. FDA00013561,Listeria sp. FDA00013562,Listeria sp. FDA00013563,Listeria sp. FDA00013564,Listeria sp. FDA00013565,Listeria sp. FDA00013566,Listeria sp. FDA00013567,Listeria sp. FDA00013568,Listeria sp. FDA00013570,Listeria sp. FDA00013571,Listeria sp. FDA00013572,Listeria sp. FDA00013573,Listeria sp. FDA00013574,Listeria sp. FDA00013575,Listeria sp. FDA00013576,Listeria sp. FDA00013577,Listeria sp. FDA00013578,Listeria sp. FDA00013579,Listeria sp. FDA00013607,"Listerella hepatolytica","Bacterium monocytogenes hominis","Corynebacterium parvulum","Corynebacterium infantisepticum" 1639 Bacillales Listeriaceae Listeria Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980) Bacteria

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F GTAAGTGGGAAATCTGTCTCAGGTGATGTAGA 32 \ 43.75 60.44 9983.55 \
R AGTTCCCATTGCCTATACAACAAACTTCTTAAAAG 35 \ 34.29 57.96 10642.02 \
P FAM-CACCGACGGCGAGACCGACTTT-TAMARA 22 \ 63.64 65.09 6705.41 \

Gene Description

Target Gene GenBank ID
hly gene NC_003210.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
In conclusion, we developed the RAA-CRISPR\Cas12a fluorescent platform for rapid, specific and sensitive nucleic acid detection of L. monocytogenes in this study. By integrating RAA into the CRISPR\Cas12a system, the proposed method showed good specificity for the detection of target bacteria, which could be completed within 30 min. RAA-CRISPR Cas12a DNAMAN software 20 min 39 °C CRISPR Cas12a 5.4 × 10−3 ng/μL,350 CFU\mL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Rapid Nucleic Acid Detection of Listeria monocytogenes Based on RAA-CRISPR Cas12a System Yujuan Yang,Xiangxiang Kong,Jielin Yang,Junxin Xue,Bing Niu,Qin Chen International journal of molecular sciences 38542449 10.3390/ijms25063477

Rapid Nucleic Acid Detection of Listeria monocytogenes Based on RAA-CRISPR Cas12a System

Author(s):

Yujuan Yang,Xiangxiang Kong,Jielin Yang,Junxin Xue,Bing Niu,Qin Chen

Journal:

International journal of molecular sciences

Year:

2024

Abstract:

Listeria monocytogenes (L. monocytogenes) is a food-borne pathogenic bacteria that frequently contaminates animal-derived food and low-temperature preserved food. Listeriosis caused by its infection has a high mortality rate and poses a serious threat to human health. Therefore, it is crucial to establish a sensitive, rapid and easy-to-operate technique. In this study, a Recombinase Aided Amplification (RAA) assisted CRISPR/Cas12a (RAA-CRISPR/Cas12a) fluorescence platform was established for highly sensitive nucleic acid detection of L. monocytogenes. The established RAA-CRISPR/Cas12a showed high sensitivity and high specificity, with the sensitivity of 350 CFU/mL and 5.4 × 10-3 ng/μL for pure bacterial solution and genomic DNA, and good specificity for 5 strains of Listeria spp. and 14 strains of other common pathogenic bacteria. L. monocytogenes could be detected at an initial concentration of 2.3 CFU/25g within 2 h of enriching the beef in the food matrix, and this method could be applied to food samples that were easily contaminated with L. monocytogenes The results of RAA-CRISPR/Cas12a could be observed in 5 min, while the amplification was completed in 20-30 min. The speed and sensitivity of RAA-CRISPR/Cas12a were significantly higher than that of the national standard method. In conclusion, the RAA-CRISPR/Cas12a system established in this study has new application potential in the diagnosis of food-borne pathogens.