| Target Pathogen | Pathogen Name | NCBI Taxonomy ID | Order | Family | Genus | Species | Pathogen type |
|---|---|---|---|---|---|---|---|
| Listeria monocytogenes | Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980),SLCC:53,"Bacterium monocytogenes","Erysipelothrix monocytogenes",Listeria sp. FDA00013359,Listeria sp. FDA00013360,Listeria sp. FDA00013361,Listeria sp. FDA00013362,Listeria sp. FDA00013363,Listeria sp. FDA00013364,Listeria sp. FDA00013365,Listeria sp. FDA00013366,Listeria sp. FDA00013367,Listeria sp. FDA00013503,Listeria sp. FDA00013504,Listeria sp. FDA00013505,Listeria sp. FDA00013506,Listeria sp. FDA00013507,Listeria sp. FDA00013508,Listeria sp. FDA00013509,Listeria sp. FDA00013510,Listeria sp. FDA00013511,Listeria sp. FDA00013512,Listeria sp. FDA00013536,Listeria sp. FDA00013537,Listeria sp. FDA00013538,Listeria sp. FDA00013539,Listeria sp. FDA00013540,Listeria sp. FDA00013541,Listeria sp. FDA00013542,Listeria sp. FDA00013543,Listeria sp. FDA00013544,Listeria sp. FDA00013545,Listeria sp. FDA00013546,Listeria sp. FDA00013547,Listeria sp. FDA00013548,Listeria sp. FDA00013549,Listeria sp. FDA00013550,Listeria sp. FDA00013551,Listeria sp. FDA00013552,Listeria sp. FDA00013553,Listeria sp. FDA00013554,Listeria sp. FDA00013555,Listeria sp. FDA00013556,Listeria sp. FDA00013557,Listeria sp. FDA00013558,Listeria sp. FDA00013559,Listeria sp. FDA00013560,Listeria sp. FDA00013561,Listeria sp. FDA00013562,Listeria sp. FDA00013563,Listeria sp. FDA00013564,Listeria sp. FDA00013565,Listeria sp. FDA00013566,Listeria sp. FDA00013567,Listeria sp. FDA00013568,Listeria sp. FDA00013570,Listeria sp. FDA00013571,Listeria sp. FDA00013572,Listeria sp. FDA00013573,Listeria sp. FDA00013574,Listeria sp. FDA00013575,Listeria sp. FDA00013576,Listeria sp. FDA00013577,Listeria sp. FDA00013578,Listeria sp. FDA00013579,Listeria sp. FDA00013607,"Listerella hepatolytica","Bacterium monocytogenes hominis","Corynebacterium parvulum","Corynebacterium infantisepticum" | 1639 | Bacillales | Listeriaceae | Listeria | Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980) | Bacteria |
| Primer Name | Sequence(5'-3') | Length(bp) | Primer Final Concentration(μM） | GC Content（%） | Predicted Melting Temperature(℃） | Molecular Weight(g/moles) | Positions in GenBank accession number |
|---|---|---|---|---|---|---|---|
| RAA-260F | GCTTAATAACCCCTGACCGCGACAAGAATAATTTG | 35 | \ | 42.86 | 62 | 10708.04 | \ |
| RAA-260R | AATCCCAATCTTCCTAACCACTGTATCCAAATTC | 34 | \ | 38.24 | 59.26 | 10224.74 | \ |
| Application | Assay | Primer Designing Software | Reaction Time(min) | Assay Temperature(℃) | Readout System(s) | Limit of Detection(LoD) | Sensitivity(%) | Specificity(%) |
|---|---|---|---|---|---|---|---|---|
| the RAA-based E-CRISPR method can be utilized in many nucleic acid biosensing platforms, thus promoting the development of biosensors and improving food safety monitoring and robust point-of-care diagnostic systems. | RAA-based E-CRISPR | Oligo 7.0 software | 30 min | 37 °C | E-CRISPR | 0.68 aM of genomic DNA and 26 cfu\mL of L. monocytogenes in pure cultures | \ | \ |
| Year of Publication | Title | Author(s) | Journal | PMID | DOI | ||
|---|---|---|---|---|---|---|---|
| 2021 | An ultrasensitive CRISPR\Cas12a based electrochemical biosensor for Listeria monocytogenes detection | Fan Li,Qinghua Ye,Moutong Chen,Baoqing Zhou,Jumei Zhang,Rui Pang,Liang Xue,Juan Wang,Haiyan Zeng,Shi Wu,Youxiong Zhang,Yu Ding,Qingping Wu | Biosensors & bioelectronics | 33581428 | 10.1016/j.bios.2021.113073 | ||
An ultrasensitive CRISPR\Cas12a based electrochemical biosensor for Listeria monocytogenes detectionAuthor(s):Fan Li,Qinghua Ye,Moutong Chen,Baoqing Zhou,Jumei Zhang,Rui Pang,Liang Xue,Juan Wang,Haiyan Zeng,Shi Wu,Youxiong Zhang,Yu Ding,Qingping WuJournal:Biosensors & bioelectronicsYear:2021Abstract:Listeria monocytogenes is an important foodborne pathogen that can cause listeriosis with high patient mortality. Accordingly, it is necessary to develop a L. monocytogenes detection platform with high specificity, sensitivity, and exploitability. CRISPR/Cas systems have shown great potential in the development of next-generation biosensors for nucleic acid detection, owing to the trans-cleavage capabilities of the Cas effector proteins. Herein, we introduce the trans-cleavage activity of CRISPR/Cas12a into an electrochemical biosensor (E-CRISPR), combined with recombinase-assisted amplification (RAA), to establish a cost-effective, specific and ultrasensitive method; namely RAA-based E-CRISPR. The concept behind this approach is that the target will induce the number change of the surface signaling probe (containing an electrochemical tag), which leads to a variation in the electron transfer of the electrochemical tag. The introduction of an RAA-based Cas12a system into the E-CRISPR sensor achieves a more prominent signal change between the presence and absence of the target. Under optimized conditions, RAA-based E-CRISPR can detect as low as 0.68 aM of genomic DNA and 26 cfu/mL of L. monocytogenes in pure cultures. More importantly, the RAA-based E-CRISPR enables rapid and ultrasensitive detection of L. monocytogenes in spiked and natural Flammulina velutipes samples. Moreover, no cross-reactivity with other non-target bacteria was observed. This system thus demonstrates to be a simple, high-sensitivity, and high-accuracy platform for L. monocytogenes detection.PMID:33581428
|
|||||||