RPB0555

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Listeria monocytogenes Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980),SLCC:53,"Bacterium monocytogenes","Erysipelothrix monocytogenes",Listeria sp. FDA00013359,Listeria sp. FDA00013360,Listeria sp. FDA00013361,Listeria sp. FDA00013362,Listeria sp. FDA00013363,Listeria sp. FDA00013364,Listeria sp. FDA00013365,Listeria sp. FDA00013366,Listeria sp. FDA00013367,Listeria sp. FDA00013503,Listeria sp. FDA00013504,Listeria sp. FDA00013505,Listeria sp. FDA00013506,Listeria sp. FDA00013507,Listeria sp. FDA00013508,Listeria sp. FDA00013509,Listeria sp. FDA00013510,Listeria sp. FDA00013511,Listeria sp. FDA00013512,Listeria sp. FDA00013536,Listeria sp. FDA00013537,Listeria sp. FDA00013538,Listeria sp. FDA00013539,Listeria sp. FDA00013540,Listeria sp. FDA00013541,Listeria sp. FDA00013542,Listeria sp. FDA00013543,Listeria sp. FDA00013544,Listeria sp. FDA00013545,Listeria sp. FDA00013546,Listeria sp. FDA00013547,Listeria sp. FDA00013548,Listeria sp. FDA00013549,Listeria sp. FDA00013550,Listeria sp. FDA00013551,Listeria sp. FDA00013552,Listeria sp. FDA00013553,Listeria sp. FDA00013554,Listeria sp. FDA00013555,Listeria sp. FDA00013556,Listeria sp. FDA00013557,Listeria sp. FDA00013558,Listeria sp. FDA00013559,Listeria sp. FDA00013560,Listeria sp. FDA00013561,Listeria sp. FDA00013562,Listeria sp. FDA00013563,Listeria sp. FDA00013564,Listeria sp. FDA00013565,Listeria sp. FDA00013566,Listeria sp. FDA00013567,Listeria sp. FDA00013568,Listeria sp. FDA00013570,Listeria sp. FDA00013571,Listeria sp. FDA00013572,Listeria sp. FDA00013573,Listeria sp. FDA00013574,Listeria sp. FDA00013575,Listeria sp. FDA00013576,Listeria sp. FDA00013577,Listeria sp. FDA00013578,Listeria sp. FDA00013579,Listeria sp. FDA00013607,"Listerella hepatolytica","Bacterium monocytogenes hominis","Corynebacterium parvulum","Corynebacterium infantisepticum" 1639 Bacillales Listeriaceae Listeria Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980) Bacteria

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F CTCGCTCTAGGTATCTTTGGGATTTACTAC 30 \ 43.33 57.7 9153.99 \
R GTCCGAATATCATTTACCTCATCAAAAGGG 30 \ 40 57.02 9174.05 \
P FITC-GTTTCATTCCTGCGTTACTATTCATTGTTG [THF]TGCTATACTTTGTTT-\C3-spacer\ 45 \ 33.33 61.15 13735.95 \

Gene Description

Target Gene GenBank ID
hlyA CP025567.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
This study has set a good example of reducing an intrinsic and non-negligible risk of RPA and LFS, which is valuable for the development of detection technologies of other public health threatening species. RPA-LFS NCBI Primer-BLAST 20 min 40°C LFS 1 CFU per reaction,100 fg of the genomic DNA\50 μl \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2020 Rapid and Specific Detection of Listeria monocytogenes With an Isothermal Amplification and Lateral Flow Strip Combined Method That Eliminates False-Positive Signals From Primer-Dimers Lei Wang,Panpan Zhao,Xinxin Si,Juan Li,Xiaofang Dai,Kunxiao Zhang,Song Gao,Jingquan Dong Frontiers in microbiology 32117075 10.3389/fmicb.2019.02959

Rapid and Specific Detection of Listeria monocytogenes With an Isothermal Amplification and Lateral Flow Strip Combined Method That Eliminates False-Positive Signals From Primer-Dimers

Author(s):

Lei Wang,Panpan Zhao,Xinxin Si,Juan Li,Xiaofang Dai,Kunxiao Zhang,Song Gao,Jingquan Dong

Journal:

Frontiers in microbiology

Year:

2020

Abstract:

Listeria monocytogenes is an important foodborne pathogenic bacterium that is explicitly threatening public health and food safety. Rapid, simple, and sensitive detection methods for this pathogen are of urgent need for the increasing on-site testing demands. Application of the isothermal recombinase polymerase amplification (RPA) and the lateral flow strip (LFS) in the detection is promising for fast speed, high sensitivity, and little dependency on equipment and trained personnel. However, the simplicity comes with an intrinsic and non-negligible risk, the false-positive signals from primer-dimers. In this study, an improved RPA-LFS system was established for detection of L. monocytogenes that eliminated false-positive signals from primer-dimers. Primer candidates were carefully selected from the entire L. monocytogenes genome sequence and rigorously screened for specific amplifications in PCR and RPA reactions. For the optimal primer pairs, probes that matched the targeted fragment sequences, although had the smallest chance to form cross-dimers with the primers, were designed and screened. The intelligent use of the probe successfully linked the positive signal to the actual amplification product. This RPA-LFS system was highly specific to L. monocytogenes and was able to detect as low as 1 colony-forming unit of the bacterium per reaction (50 μl) without DNA purification, or 100 fg of the genomic DNA/50 μl. The amplification could be conducted under the temperature between 37 and 42°C, and the whole detection finished within 25 min. Test of artificially contaminated milk gave 100% accuracy of detection without purification of the samples. Various food samples spiked with 10 colony-forming unit of L. monocytogenes per 25 g or 25 ml were successfully detected after an enrichment time period of 6 h. The RPA-LFS system established in this study is a rapid, simple, and specific detection method for L. monocytogenes that has eliminated false-positive results from primer-dimers. In addition, this study has set a good example of eliminating the false-positive risk from primer-dimers in isothermal amplification-based detection methods, which is applicable to the development of detection technologies for other pathogens.