| Target Pathogen | Pathogen Name | NCBI Taxonomy ID | Order | Family | Genus | Species | Pathogen type |
|---|---|---|---|---|---|---|---|
| Listeria monocytogenes | Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980),SLCC:53,"Bacterium monocytogenes","Erysipelothrix monocytogenes",Listeria sp. FDA00013359,Listeria sp. FDA00013360,Listeria sp. FDA00013361,Listeria sp. FDA00013362,Listeria sp. FDA00013363,Listeria sp. FDA00013364,Listeria sp. FDA00013365,Listeria sp. FDA00013366,Listeria sp. FDA00013367,Listeria sp. FDA00013503,Listeria sp. FDA00013504,Listeria sp. FDA00013505,Listeria sp. FDA00013506,Listeria sp. FDA00013507,Listeria sp. FDA00013508,Listeria sp. FDA00013509,Listeria sp. FDA00013510,Listeria sp. FDA00013511,Listeria sp. FDA00013512,Listeria sp. FDA00013536,Listeria sp. FDA00013537,Listeria sp. FDA00013538,Listeria sp. FDA00013539,Listeria sp. FDA00013540,Listeria sp. FDA00013541,Listeria sp. FDA00013542,Listeria sp. FDA00013543,Listeria sp. FDA00013544,Listeria sp. FDA00013545,Listeria sp. FDA00013546,Listeria sp. FDA00013547,Listeria sp. FDA00013548,Listeria sp. FDA00013549,Listeria sp. FDA00013550,Listeria sp. FDA00013551,Listeria sp. FDA00013552,Listeria sp. FDA00013553,Listeria sp. FDA00013554,Listeria sp. FDA00013555,Listeria sp. FDA00013556,Listeria sp. FDA00013557,Listeria sp. FDA00013558,Listeria sp. FDA00013559,Listeria sp. FDA00013560,Listeria sp. FDA00013561,Listeria sp. FDA00013562,Listeria sp. FDA00013563,Listeria sp. FDA00013564,Listeria sp. FDA00013565,Listeria sp. FDA00013566,Listeria sp. FDA00013567,Listeria sp. FDA00013568,Listeria sp. FDA00013570,Listeria sp. FDA00013571,Listeria sp. FDA00013572,Listeria sp. FDA00013573,Listeria sp. FDA00013574,Listeria sp. FDA00013575,Listeria sp. FDA00013576,Listeria sp. FDA00013577,Listeria sp. FDA00013578,Listeria sp. FDA00013579,Listeria sp. FDA00013607,"Listerella hepatolytica","Bacterium monocytogenes hominis","Corynebacterium parvulum","Corynebacterium infantisepticum" | 1639 | Bacillales | Listeriaceae | Listeria | Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980) | Bacteria |
| Primer Name | Sequence(5'-3') | Length(bp) | Primer Final Concentration(μM) | GC Content(%) | Predicted Melting Temperature(℃) | Molecular Weight(g/moles) | Positions in GenBank accession number |
|---|---|---|---|---|---|---|---|
| hly-P3F | GCAACAAACTGAAGCAAAGGAT | 22 | 420 nM | 40.91 | 53.81 | 6794.53 | \ |
| hly-P3R | CGATTGGCGTCTTAGGACTTGC | 22 | 420 nM | 54.55 | 58.81 | 6757.44 | \ |
| hly-exo-P | TCTGCATTCAATAAAGAAAATTCAATTTCA1CZA2GGCACCACCAGCATC 1:[T(FAM)], Z:[THF], 2: [T(BHQ-1)] | 47 | 420 nM | 38.3 | 65.03 | 14327.41 | \ |
| Application | Assay | Primer Designing Software | Reaction Time(min) | Assay Temperature(℃) | Readout System(s) | Limit of Detection(LoD) | Sensitivity(%) | Specificity(%) |
|---|---|---|---|---|---|---|---|---|
| Faster detection of foodborne pathogens is of paramount importance to the food industry where rapid recognition of potential sources of contamination is essential for the development and implementation of effective corrective measures to mitigate the spread of foodborne hazards. | RPA | \ | 50 min | 39 °C | \ | 2.8 pg/μL | \ | \ |
| Year of Publication | Title | Author(s) | Journal | PMID | DOI | ||
|---|---|---|---|---|---|---|---|
| 2020 | Comparative study of multiplex real-time recombinase polymerase amplification and ISO 11290-1 methods for the detection of Listeria monocytogenes in dairy products | Alejandro Garrido-Maestu,Sarah Azinheiro,Pablo Fuciños,Joana Carvalho,Marta Prado | Food microbiology | 32950155 | 10.1016/j.fm.2020.103570 | ||
Comparative study of multiplex real-time recombinase polymerase amplification and ISO 11290-1 methods for the detection of Listeria monocytogenes in dairy productsAuthor(s):Alejandro Garrido-Maestu,Sarah Azinheiro,Pablo Fuciños,Joana Carvalho,Marta PradoJournal:Food microbiologyYear:2020Abstract:Dairy products have been implicated in foodborne infections caused by different bacterial pathogens. Among them, Listeria monocytogenes is of particular concern due to its ubiquity, resistance to sanitation processes and high mortality rates resulting from infection. These issues make the development of novel methods for the rapid detection of this bacterium of high interest. The evaluation of a novel multiplex real-time Recombinase Polymerase Amplification method including an internal amplification control is reported in the present work. The method performance was compared to that of the European reference method (ISO 11290-1) for the detection of the species in samples from 40 commercial products, including 14 UHT milk samples, 16 hard cheese samples, 6 infant dairy preparation samples and 4 fresh cheese samples. A limit of detection below 10 cfu/25 g or mL sample was achieved, and values higher than 90% were obtained for relative sensitivity, specificity, accuracy, positive and negative predictive values and the index (kappa) of concordance. Analysis was achieved within one working day, compared to the six days required using the ISO method. Moreover, slight modification of the ISO 11290-1 method to include secondary enrichment in half Fraser broth resulted in the confirmation of all positive samples.PMID:32950155
|
|||||||