RPB0552

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Listeria monocytogenes Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980),SLCC:53,"Bacterium monocytogenes","Erysipelothrix monocytogenes",Listeria sp. FDA00013359,Listeria sp. FDA00013360,Listeria sp. FDA00013361,Listeria sp. FDA00013362,Listeria sp. FDA00013363,Listeria sp. FDA00013364,Listeria sp. FDA00013365,Listeria sp. FDA00013366,Listeria sp. FDA00013367,Listeria sp. FDA00013503,Listeria sp. FDA00013504,Listeria sp. FDA00013505,Listeria sp. FDA00013506,Listeria sp. FDA00013507,Listeria sp. FDA00013508,Listeria sp. FDA00013509,Listeria sp. FDA00013510,Listeria sp. FDA00013511,Listeria sp. FDA00013512,Listeria sp. FDA00013536,Listeria sp. FDA00013537,Listeria sp. FDA00013538,Listeria sp. FDA00013539,Listeria sp. FDA00013540,Listeria sp. FDA00013541,Listeria sp. FDA00013542,Listeria sp. FDA00013543,Listeria sp. FDA00013544,Listeria sp. FDA00013545,Listeria sp. FDA00013546,Listeria sp. FDA00013547,Listeria sp. FDA00013548,Listeria sp. FDA00013549,Listeria sp. FDA00013550,Listeria sp. FDA00013551,Listeria sp. FDA00013552,Listeria sp. FDA00013553,Listeria sp. FDA00013554,Listeria sp. FDA00013555,Listeria sp. FDA00013556,Listeria sp. FDA00013557,Listeria sp. FDA00013558,Listeria sp. FDA00013559,Listeria sp. FDA00013560,Listeria sp. FDA00013561,Listeria sp. FDA00013562,Listeria sp. FDA00013563,Listeria sp. FDA00013564,Listeria sp. FDA00013565,Listeria sp. FDA00013566,Listeria sp. FDA00013567,Listeria sp. FDA00013568,Listeria sp. FDA00013570,Listeria sp. FDA00013571,Listeria sp. FDA00013572,Listeria sp. FDA00013573,Listeria sp. FDA00013574,Listeria sp. FDA00013575,Listeria sp. FDA00013576,Listeria sp. FDA00013577,Listeria sp. FDA00013578,Listeria sp. FDA00013579,Listeria sp. FDA00013607,"Listerella hepatolytica","Bacterium monocytogenes hominis","Corynebacterium parvulum","Corynebacterium infantisepticum" 1639 Bacillales Listeriaceae Listeria Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980) Bacteria

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F TTCAATTTCATCCATGGCAC 20 \ 40 50.47 6027 \
R CTTTGTAACCTTTTCTTGGC 20 \ 40 48.85 6039.98 \
P [FAM]ACGCCAATCGAAAA-GAAACACGC[BHQ-1] 23 \ 47.83 58.95 7028.68 \

Gene Description

Target Gene GenBank ID
\ \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Our assay can be extended for the detection of other species, including Gram-positive and Gram-negative bacteria in whole blood. ITP purification has potential to expand the applicability of RPA to blood samples. RPA-ITP \ 25 min 40 °C ITP 2 × 104 cells per mL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2016 Assay for Listeria monocytogenes cells in whole blood using isotachophoresis and recombinase polymerase amplification Charbel Eid,Juan G Santiago The Analyst 27904893 10.1039/c6an02119k

Assay for Listeria monocytogenes cells in whole blood using isotachophoresis and recombinase polymerase amplification

Author(s):

Charbel Eid,Juan G Santiago

Journal:

The Analyst

Year:

2016

Abstract:

We present a new approach which enables lysis, extraction, and detection of inactivated Listeria monocytogenes cells from blood using isotachophoresis (ITP) and recombinase polymerase amplification (RPA). We use an ITP-compatible alkaline and proteinase K approach for rapid and effective lysis. We then perform ITP purification to separate bacterial DNA from whole blood contaminants using a microfluidic device that processes 25 μL sample volume. Lysis, mixing, dispensing, and on-chip ITP purification are completed in a total of less than 50 min. We transfer extracted DNA directly into RPA master mix for isothermal incubation and detection, an additional 25 min. We first validate our assay in the detection of purified genomic DNA spiked into whole blood, and demonstrate a limit of detection of 16.7 fg μL-1 genomic DNA, the equivalent of 5 × 103 cells per mL. We then show detection of chemically-inactivated L. monocytogenes cells spiked into whole blood, and demonstrate a limit of detection of 2 × 104 cells per mL. Lastly, we show preliminary experimental data demonstrating the feasibility of the integration of ITP purification with RPA detection on a microfluidic chip. Our results suggest that ITP purification is compatible with RPA detection, and has potential to extend the applicability of RPA to whole blood.