RPB0551

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Listeria monocytogenes Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980),SLCC:53,"Bacterium monocytogenes","Erysipelothrix monocytogenes",Listeria sp. FDA00013359,Listeria sp. FDA00013360,Listeria sp. FDA00013361,Listeria sp. FDA00013362,Listeria sp. FDA00013363,Listeria sp. FDA00013364,Listeria sp. FDA00013365,Listeria sp. FDA00013366,Listeria sp. FDA00013367,Listeria sp. FDA00013503,Listeria sp. FDA00013504,Listeria sp. FDA00013505,Listeria sp. FDA00013506,Listeria sp. FDA00013507,Listeria sp. FDA00013508,Listeria sp. FDA00013509,Listeria sp. FDA00013510,Listeria sp. FDA00013511,Listeria sp. FDA00013512,Listeria sp. FDA00013536,Listeria sp. FDA00013537,Listeria sp. FDA00013538,Listeria sp. FDA00013539,Listeria sp. FDA00013540,Listeria sp. FDA00013541,Listeria sp. FDA00013542,Listeria sp. FDA00013543,Listeria sp. FDA00013544,Listeria sp. FDA00013545,Listeria sp. FDA00013546,Listeria sp. FDA00013547,Listeria sp. FDA00013548,Listeria sp. FDA00013549,Listeria sp. FDA00013550,Listeria sp. FDA00013551,Listeria sp. FDA00013552,Listeria sp. FDA00013553,Listeria sp. FDA00013554,Listeria sp. FDA00013555,Listeria sp. FDA00013556,Listeria sp. FDA00013557,Listeria sp. FDA00013558,Listeria sp. FDA00013559,Listeria sp. FDA00013560,Listeria sp. FDA00013561,Listeria sp. FDA00013562,Listeria sp. FDA00013563,Listeria sp. FDA00013564,Listeria sp. FDA00013565,Listeria sp. FDA00013566,Listeria sp. FDA00013567,Listeria sp. FDA00013568,Listeria sp. FDA00013570,Listeria sp. FDA00013571,Listeria sp. FDA00013572,Listeria sp. FDA00013573,Listeria sp. FDA00013574,Listeria sp. FDA00013575,Listeria sp. FDA00013576,Listeria sp. FDA00013577,Listeria sp. FDA00013578,Listeria sp. FDA00013579,Listeria sp. FDA00013607,"Listerella hepatolytica","Bacterium monocytogenes hominis","Corynebacterium parvulum","Corynebacterium infantisepticum" 1639 Bacillales Listeriaceae Listeria Listeria monocytogenes (Murray et al. 1926) Pirie 1940 (Approved Lists 1980) Bacteria

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
hly-P3F GCAACAAACTGAAGCAAAGGAT 22 420 nM 40.91 53.81 6794.53 \
hly-P3R CGATTGGCGTCTTAGGACTTGC 22 420 nM 54.55 58.81 6757.44 \
hly-LF-P TCTGCATTCAATAAAGAAAATTCAATTTCATCZATGGCACCACCAGCATC 5′-FAM\THF\SpC3 *-3′ 49 120 nM 36.73 64.64 14935.8 \

Gene Description

Target Gene GenBank ID
hlyA \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Overall, the novel methodology has great potential for its implementation in the food industry to improve the current culture-based testing methodologies. RPA-LF \ 40 min 39 °C LFS 1.1 pg\µL of pure L. monocytogenes DNA,LOD50 of 4.2 CFU\cm2,LOD95 of 18.2 CFU\cm2 \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2020 Application of Recombinase Polymerase Amplification with Lateral Flow for a Naked-Eye Detection of Listeria monocytogenes on Food Processing Surfaces Sarah Azinheiro,Joana Carvalho,Marta Prado,Alejandro Garrido-Maestu Foods (Basel, Switzerland) 32906705 10.3390/foods9091249

Application of Recombinase Polymerase Amplification with Lateral Flow for a Naked-Eye Detection of Listeria monocytogenes on Food Processing Surfaces

Author(s):

Sarah Azinheiro,Joana Carvalho,Marta Prado,Alejandro Garrido-Maestu

Journal:

Foods (Basel, Switzerland)

Year:

2020

Abstract:

The continuous contamination of foods with L. monocytogenes, highlights the need for additional controls in the food industry. The verification of food processing plants is key to avoid cross-contaminations, and to assure the safety of the food products. In this study, a new methodology for the detection of L. monocytogenes on food contact surfaces was developed and evaluated. It combines Recombinase Polymerase Amplification (RPA) with the lateral flow (LF) naked-eye detection. Different approaches for the recovery of the bacteria from the surface, the enrichment step and downstream analysis by RPA-LF were tested and optimized. The results were compared with a standard culture-based technique and qPCR analysis. Sampling procedure with sponges was more efficient for the recovery of the bacteria than a regular swab. A 24 h enrichment in ONE broth was needed for the most sensitive detection of the pathogen. By RPA-LF, it was possible to detect 1.1 pg/µL of pure L. monocytogenes DNA, and the complete methodology reached a LoD50 of 4.2 CFU/cm2 and LoD95 of 18.2 CFU/cm2. These results are comparable with the culture-based methodology and qPCR. The developed approach allows for a next-day detection without complex equipment and a naked-eye visualization of the results.