RPB0546

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Tick-Borne Encephalitis Virus Tick-borne encephalitis virus,TBEV,FSME virus,Tick born encephalitis virus,tick-borne encephalitis virus TBE virus,tick-borne encephalitis virus TBEV 11084 Amarillovirales Flaviviridae Orthoflavivirus Orthoflavivirus encephalitidis Viruses

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
RAA-F GAAATTAATACGACTCACTATAGGGCTTATGGGCAGATGTGGCTGCTGAGTTACTTC 57 \ 43.86 68.13 17637.49 \
RAA-R CATCCAACATGTCCTCTGTGGTCATCCAGGCTC 33 \ 54.55 67.04 10000.53 \

Gene Description

Target Gene GenBank ID
NS5 gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
With a short reaction time of up to 60 min, easy-to-read results interpretation, and modest requisites for equipment and operational expertise, the RT-RAA-CRISPR\Cas13a-LFD assay is promising for compensating for the disadvantages of current laboratory methods. RT-RAA-CRISPR\Cas13a-LFD Oligo7 software 30 min 42 °C CRISPR\Cas13a-LFD 50 CFU\ml 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 A novel rapid visual nucleic acid detection technique for tick-borne encephalitis virus by combining RT-recombinase-aided amplification and CRISPR\Cas13a coupled with a lateral flow dipstick Han Zhang,Yanan Wang,Changguo Chen,Weiwei Xing,Wenrong Xia,Wenliang Fu,Aijun Liu,Chao Zhang,Qun Guan,Yongqi Zhao,Gang Sun,Desheng Lu,Zhanzhu Dong,Zizhuo Li,Yaguang Zhou,Suli Zhang,Yandan Du,Chunfu Zheng,Donggang Xu International journal of biological macromolecules 38987000 10.1016/j.ijbiomac.2024.133720

A novel rapid visual nucleic acid detection technique for tick-borne encephalitis virus by combining RT-recombinase-aided amplification and CRISPR\Cas13a coupled with a lateral flow dipstick

Author(s):

Han Zhang,Yanan Wang,Changguo Chen,Weiwei Xing,Wenrong Xia,Wenliang Fu,Aijun Liu,Chao Zhang,Qun Guan,Yongqi Zhao,Gang Sun,Desheng Lu,Zhanzhu Dong,Zizhuo Li,Yaguang Zhou,Suli Zhang,Yandan Du,Chunfu Zheng,Donggang Xu

Journal:

International journal of biological macromolecules

Year:

2024

Abstract:

Tick-borne encephalitis virus (TBEV), a zoonotic pathogen, can cause severe neurological complications and fatal outcomes in humans. Early diagnosis of TBEV infection is crucial for clinical practice. Although serological assays are frequently employed for detection, the lack of antibodies in the early stages of infection and the cross-reactivity of antibodies limit their efficacy. Conventional molecular diagnostic methods such as RT-qPCR can achieve early and accurate identification but require specialized instrumentation and professionals, hindering their application in resource-limited areas. Our study developed a rapid and visual TBEV molecular detection method by combining RT-recombinase-aided amplification, the CRISPR/Cas13a system, and lateral flow dipsticks. The diagnostic sensitivity of this method is 50 CFU/ml, with no cross-reactivity with a variety of viruses. The detection can be carried out within 1 h at a temperature between 37 and 42 °C, and the results can be visually determined without the need for complex instruments and professionals. Subsequently, this assay was used to analyze clinical samples from 15 patients suspected of TBEV infection and 10 healthy volunteers, and its sensitivity and specificity reached 100 %, which was consistent with the results of RT-qPCR. These results indicate that this new method can be a promising point-of-care test for the diagnosis of tick-borne encephalitis.