RPB0542

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
N. meningitidis Neisseria meningitidis,personal::Sara E. Branham M1027,"Diplokokkus intracellularis meningitidis","Micrococcus meningitidis","Neisseria weichselbaumii","Micrococcus intracellularis","Micrococcus meningitidis cerebrospinalis" 487 Neisseriales Neisseriaceae Neisseria Neisseria meningitidis Bacteria

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F CGTCTGTGCTCGAAATAGGATAAAGGCAGGGAAA*G 35 0.48 μM 48.57 64.66 10934.22 1295659-1297887
R CACCTGCATAACGCATAGGAGGGAAATGGTTATT*A 35 0.48 μM 42.86 62.36 10844.17 1295659-1297887
P ACATCAATGATGACAAACCTTACTAGCGG[T(FAM)](dSpacer)A[T(BHQ1)]TGGGATCCATC*G(C3 Spacer) 35 0.12 μM 42.86 62.36 10844.17 1295659-1297887

Gene Description

Target Gene GenBank ID
Higgins, pers. comm AM889136.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
RPA, a recently developed isothermal nucleic acid amplification method, offers very rapid and robust detection of infectious disease pathogens, making it an ideal POC diagnostic option for low-resource disease-burdened areas. RPA \ 20 min 40 °C \ 8.5 genome copies per reaction 0.863 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2018 Duplex recombinase polymerase amplification assays incorporating competitive internal controls for bacterial meningitis detection Owen Higgins,Eoin Clancy,Matthew S Forrest,Olaf Piepenburg,Martin Cormican,Teck Wee Boo,Nicola O'Sullivan,Claire McGuinness,Deirdre Cafferty,Robert Cunney,Terry J Smith Analytical biochemistry 29378166 10.1016/j.ab.2018.01.016

Duplex recombinase polymerase amplification assays incorporating competitive internal controls for bacterial meningitis detection

Author(s):

Owen Higgins,Eoin Clancy,Matthew S Forrest,Olaf Piepenburg,Martin Cormican,Teck Wee Boo,Nicola O'Sullivan,Claire McGuinness,Deirdre Cafferty,Robert Cunney,Terry J Smith

Journal:

Analytical biochemistry

Year:

2018

Abstract:

Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technology that provides rapid and robust infectious disease pathogen detection, ideal for point-of-care (POC) diagnostics in disease-prevalent low-resource countries. We have developed and evaluated three duplex RPA assays incorporating competitive internal controls for the detection of leading bacterial meningitis pathogens. Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae singleplex RPA assays were initially developed and evaluated, demonstrating 100% specificity with limits of detection of 4.1, 8.5 and 3.9 genome copies per reaction, respectively. Each assay was further developed into internally controlled duplex RPA assays via the incorporation of internal amplification control templates. Clinical performance of each internally controlled duplex RPA assay was evaluated by testing 64 archived PCR-positive clinical samples. Compared to real-time PCR, all duplex RPA assays demonstrated 100% diagnostic specificity, with diagnostic sensitivities of 100%, 86.3% and 100% for the S. pneumoniae, N. meningitidis and H. influenzae assays, respectively. This study details the first report of internally controlled duplex RPA assays for the detection of bacterial meningitis pathogens: S. pneumoniae, N. meningitidis and H. influenzae. We have successfully demonstrated the clinical diagnostic utility of each duplex RPA assay, introducing effective diagnostic technology for POC bacterial meningitis identification in disease-prevalent developing countries.