| Target Pathogen | Pathogen Name | NCBI Taxonomy ID | Order | Family | Genus | Species | Pathogen type |
|---|---|---|---|---|---|---|---|
| Japanese Encephalitis Virus | Japanese encephalitis virus,Japanese encephalitis (JE) virus,Japanese encephalitis virus JE,Japanese encephalitis virus JEV | 11072 | Amarillovirales | Flaviviridae | Orthoflavivirus | Orthoflavivirus japonicum | Viruses |
| Primer Name | Sequence(5'-3') | Length(bp) | Primer Final Concentration(μM) | GC Content(%) | Predicted Melting Temperature(℃) | Molecular Weight(g/moles) | Positions in GenBank accession number |
|---|---|---|---|---|---|---|---|
| JEV GI-F | GACAGCAGCTACGTGTGCAAACAAGGCTTT | 30 | 10 μM | 50 | 65.15 | 9240.07 | \ |
| JEV GI-R | CCGAGGTGGTGGTTCCGTGCACGAATATGC | 30 | 10 μM | 60 | 69 | 9279.05 | \ |
| Application | Assay | Primer Designing Software | Reaction Time(min) | Assay Temperature(℃) | Readout System(s) | Limit of Detection(LoD) | Sensitivity(%) | Specificity(%) |
|---|---|---|---|---|---|---|---|---|
| We have achieved sensitive and rapid genotype-specific detection of JEV using DETECTR. | RT-RPA-CRISPR-Cas12a | NCBI database | 40 min | 42°C | CRISPR-Cas12a | 10 RNA copies | \ | \ |
| Year of Publication | Title | Author(s) | Journal | PMID | DOI | ||
|---|---|---|---|---|---|---|---|
| 2023 | A CRISPR-Cas12a-Based Diagnostic Method for Japanese Encephalitis Virus Genotypes I, III, and V | Namki Kwak,Bum Ju Park,Yoon-Jae Song | Biosensors | 37622855 | 10.3390/bios13080769 | ||
A CRISPR-Cas12a-Based Diagnostic Method for Japanese Encephalitis Virus Genotypes I, III, and VAuthor(s):Namki Kwak,Bum Ju Park,Yoon-Jae SongJournal:BiosensorsYear:2023Abstract:The Japanese encephalitis virus (JEV) is prevalent in Asian countries, including Korea, Japan, China, Vietnam, and India. JEV is transmitted to humans by Culex mosquitoes. Despite extensive research efforts, no approved antiviral agents are currently available, although JE can be prevented by vaccination. DNA endonuclease-targeted CRISPR trans reporter (DETECTR) is a newly emerging CRISPR-Cas12a-based molecular diagnostic method combined with isothermal nucleic acid amplification. In this study, DETECTR with reverse transcription-recombinase polymerase amplification (RT-RPA) was effectively utilized for JEV diagnosis and detected down to 10 RNA copies for JEV genotype I (GI) and 1 × 102 copies for both GIII and GV, achieving similar sensitivity to RT-PCR while displaying no cross-reaction with other viruses. A one-tube, one-temperature format of DETECTR was further developed, and its efficiency compared with that of conventional DETECTR.PMID:37622855
|
|||||||