RPB0513

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Group B Streptococcus Streptococcus sp. 'group B' 1319 Lactobacillales Streptococcaceae Streptococcus Streptococcus sp. 'group B' Bacteria

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F2 CAGGGTTGGCACGCAATGAAGTCTTTAATTTTTC 34 10 μM 41.18 61.48 10462.85 2045109 ~ 2045876
R2 AATAATCAAGCCCAGCAAATGGCTCAAAAGC 31 10 μM 41.94 61.55 9499.28 2045109 ~ 2045876
P2 CTGAACATTATCTTTGATATTTC (CY3-dT)C (THF)AC (BHQ1-dT)GAATGCTATCTTGATC-C3spacer 42 10 μM 33.33 58.83 12803.39 2045109 ~ 2045876

Gene Description

Target Gene GenBank ID
SIP CP021867.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
The PMA-RPA assay is a promising technology for field tests and rapid point-of-care diagnosis. PMA-RPA \ 20min 37 RPA 100 copies/reaction \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2018 Development of propidium monoazide-recombinase polymerase amplification (PMA-RPA) assay for rapid detection of Streptococcus pyogenes and Streptococcus agalactiae Jing Chen,Yuanyang Wang,Xiaoqing Liu,Guopei Chen,Xuejian Chen,Jiaping Chen,Zhongdong Liu,Jingwen Gong,Guowu Yang,Quanxue Lan Molecular and cellular probes 30170103 10.1016/j.mcp.2018.08.007

Development of propidium monoazide-recombinase polymerase amplification (PMA-RPA) assay for rapid detection of Streptococcus pyogenes and Streptococcus agalactiae

Author(s):

Jing Chen,Yuanyang Wang,Xiaoqing Liu,Guopei Chen,Xuejian Chen,Jiaping Chen,Zhongdong Liu,Jingwen Gong,Guowu Yang,Quanxue Lan

Journal:

Molecular and cellular probes

Year:

2018

Abstract:

Streptococcus pyogenes (Group A Streptococcus, GAS) and Streptococcus agalactiae (Group B Streptococcus, GBS) are common pathogens that threaten public health. In this study, a double recombinase polymerase (RPA) amplification assay was developed to rapidly detect these pathogens. Specificity tests revealed that the GAS and GBS strains were positive for speB and SIP genes, respectively. In clinical samples, the double assay performed similarly to the traditional biochemical method. The limits of detection were both ≤100 copies per reaction. In tests for simulant-contaminated samples, bacterial-culture media containing 103 CFU/mL original concentrations of S. pyogenes and S. agalactiae were positive in RPA assays after incubating for 4 h. Results can be obtained at 37 °C in 20 min. To determine whether propidium monoazide (PMA) can eliminate the influence of DNA extracted from dead cells, a bacterial suspension was treated with PMA before DNA extraction. Findings of RPA assay showed that DNA extracted from dead cells had no fluorescence signal. Therefore, the PMA-RPA assay is a promising technology for field tests and rapid point-of-care diagnosis.