RPB0496

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
EV-A71 Enterovirus 71, Enterovirus EV-A71, Human enterovirus 71, Human enterovirus A71, Human enterovirus type 71, enterovirus type 71 39054 Picornavirales Picornaviridae Enterovirus Enterovirus A Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
EV71-LF-F CCTGCGAGTGCTTACCAATGGTTTTATGACGG 32 10 μM 50 67.22 9846.43 3026–3057
EV 71-LF-R Biotin-GTATCCACGCCCTGACGTGCTTCATTCTCAT 34 10 μM 50.5 69.19 10293.8 3194–3224
EV71-LF-P FAM-AACATGATGGGCACGTTCTCAGTGCGGAC -[THF]-TGGGGACCTCCAAGTC-C3-spacer 29 10 μM 55.17 69.82 8942.86 3119-3165

Gene Description

Target Gene GenBank ID
VP1 \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Duplex real time reverse-transcription recombinase aided amplification (RT-RAA) assays incorporating competitive internal amplification controls (IAC) and visible RT-RAA assays combined with lateral flow strip (LFS) for detection of EV71 LFS RT-RAA \ 30 min 42 LFS 10 copies/reaction 10 copies/reaction 99.7

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2019 Applicability of duplex real time and lateral flow strip reverse-transcription recombinase aided amplification assays for the detection of Enterovirus 71 and Coxsackievirus A16 Xin-Na Li,Xin-Xin Shen,Ming-Hui Li,Ju-Ju Qi,Rui-Huan Wang,Qing-Xia Duan,Rui-Qing Zhang,Tao Fan,Xue-Ding Bai,Guo-Hao Fan,Yao Xie,Xue-Jun Ma Virology journal 31888694 10.1186/s12985-019-1264-z

Applicability of duplex real time and lateral flow strip reverse-transcription recombinase aided amplification assays for the detection of Enterovirus 71 and Coxsackievirus A16

Author(s):

Xin-Na Li,Xin-Xin Shen,Ming-Hui Li,Ju-Ju Qi,Rui-Huan Wang,Qing-Xia Duan,Rui-Qing Zhang,Tao Fan,Xue-Ding Bai,Guo-Hao Fan,Yao Xie,Xue-Jun Ma

Journal:

Virology journal

Year:

2019

Abstract:

Background: Enterovirus 71 (EV71) and coxsackievirus A16 (CA16) are the two main etiological agents of Hand, Foot and Mouth Disease (HFMD). Simple and rapid detection of EV71 and CA16 is critical in resource-limited settings. Methods: Duplex real time reverse-transcription recombinase aided amplification (RT-RAA) assays incorporating competitive internal amplification controls (IAC) and visible RT-RAA assays combined with lateral flow strip (LFS) for detection of EV71 and CA16 were developed respectively. Duplex real time RT-RAA assays were performed at 42 °C within 30 min using a portable real-time fluorescence detector, while LFS RT-RAA assays were performed at 42 °C within 30 min in an incubator. Recombinant plasmids containing conserved VP1 genes were used to analyze the sensitivities of these two methods. A total of 445 clinical specimens from patients who were suspected of being infected with HFMD were used to evaluate the performance of the assays. Results: The limit of detection (LoD) of the duplex real time RT-RAA for EV71 and CA16 was 47 copies and 38 copies per reaction, respectively. The LoD of the LFS RT-RAA for EV71 and CA16 were both 91 copies per reaction. There was no cross reactivity with other enteroviruses. Compared to reverse transcription-quantitative PCR (RT-qPCR), the clinical diagnostic sensitivities of the duplex real time RT-RAA assay were 92.3% for EV71 and 99.0% for CA16, and the clinical diagnostic specificities were 99.7 and 100%, respectively. The clinical diagnostic sensitivities of the LFS RT-RAA assay were 90.1% for EV71 and 94.9% for CA16, and the clinical diagnostic specificities were 99.7 and 100%, respectively. Conclusions: The developed duplex real time RT-RAA and LFS RT-RAA assays for detection of EV71 and CA16 are potentially suitable in primary clinical settings.