RPB0443

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Nipah virus Nipah henipavirus 121791 Mononegavirales Paramyxoviridae Henipavirus Nipah virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
NiV F6 ATTCTTCGCAACCATCAGATTYGGGTTGGAG 31 420 nM 46.77 63.17 9533.75 694-993 nt
NiV P2 [5'Biotin]ATTCCAGAGTGACCTCAACACCATCAARAGC[Internal dS spacer]TGATGCTACTCTACAG[3'C3 spacer 47 420 nM 45.74 67.64 14352.4 694-993 nt
RT-RPANFO and RT-RPAExo. [5'FAM]TCAAGAAGCACCATATAAGGGGCTCTTGGG 30 120 nM 50 63.7 9280.09 694-993 nt
RT-RAA. [5'FAM]TTAGTCTGAATTGATTCTTCAAGAAGCACC 30 120 nM 36.67 56.4 9180.05 694-993 nt

Gene Description

Target Gene GenBank ID
Nucleocapsid protein (N) gene JN808863.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapidity, simplicity, and low equipment requirements. RT-RAA-LFD\RT-nfoRPA-LFD\RT-exoRPA-LFD Primer-BLAST 20 min 39°C NOF\EXO 100-200 RNA copies/reaction NiV NFO:100.0%（95% CI：79.4–100.0%）,NiV EXO:93.8%（95% CI：69.8–99.8%）和 NiV RAA:62.5%（95% CI：35.4–84.8%） 100.0%（95% CI：29.24–100.0%）NiV EXO 、NiV RAA 100%（95% CI：29.2–100.0%）

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Evaluation of three rapid low-resource molecular tests for Nipah virus Nina M Pollak,Malin Olsson,Glenn A Marsh,Joanne Macdonald,David McMillan Frontiers in Microbiology 36845977 10.3389/fmicb.2022.1101914

Evaluation of three rapid low-resource molecular tests for Nipah virus

Author(s):

Nina M Pollak,Malin Olsson,Glenn A Marsh,Joanne Macdonald,David McMillan

Journal:

Frontiers in Microbiology

Year:

2023

Abstract:

Accurate and timely diagnosis of Nipah virus (NiV) requires rapid, inexpensive, and robust diagnostic tests to control spread of disease. Current state of the art technologies are slow and require laboratory infrastructure that may not be available in all endemic settings. Here we report the development and comparison of three rapid NiV molecular diagnostic tests based on reverse transcription recombinase-based isothermal amplification coupled with lateral flow detection. These tests include a simple and fast one-step sample processing step that inactivates the BSL-4 pathogen, enabling safe testing without the need for multi-step RNA purification. The rapid NiV tests targeted the Nucleocapsid protein (N) gene with analytical sensitivity down to 1,000 copies/μL for synthetic NiV RNA and did not cross-react with RNA of other flaviviruses or Chikungunya virus, which can clinically present with similar febrile symptoms. Two tests detected 50,000-100,000 TCID50/mL (100-200 RNA copies/reaction) of the two distinct strains of NiV, Bangladesh (NiVB) and Malaysia (NiVM), and took 30 min from sample to result, suggesting these tests are well suited for rapid diagnosis under resource-limited conditions due to rapidity, simplicity, and low equipment requirements. These Nipah tests represent a first step toward development of near-patient NiV diagnostics that are appropriately sensitive for first-line screening, sufficiently robust for a range of peripheral settings, with potential to be safely performed outside of biohazard containment facilities.