RPB0439

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
WPRE RPA forward primer gaaattaatacgactcactataGGTATTCTTAACTATGTTGCTCCTTTTACG 52 10 μM 32.69 60.43 15916.41 \
WPRE RPA reverse primer CAGGATTTATACAAGGAGGAGAAAATGAAA 30 10 μM 33.33 54.19 9369.2 \

Gene Description

Target Gene GenBank ID
WPRE \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a simple and affordable way to detect SARS-CoV-2 in wastewater with high sensitivity and specificity, meeting the high demand of monitoring viruses in wastewater for the prevention of the viral pandemic. RT-RAA-CRISPR Cas13a \ 30 min 42 °C CRISPR Cas13a 10³ copies\mL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Field-deployable assay based on CRISPR-Cas13a coupled with RT-RPA in one tube for the detection of SARS-CoV-2 in wastewater Yihan Yang,Fan Wang,Boyuan Xue,Xiaohong Zhou Journal Of Hazardous Materials 37473568 10.1016/j.jhazmat.2023.132077

Field-deployable assay based on CRISPR-Cas13a coupled with RT-RPA in one tube for the detection of SARS-CoV-2 in wastewater

Author(s):

Yihan Yang,Fan Wang,Boyuan Xue,Xiaohong Zhou

Journal:

Journal Of Hazardous Materials

Year:

2023

Abstract:

CRISPR-based nucleic acid detection is easy to implement, field deployable, and always coupled with isothermal amplification to improve the sensitivity. However, the conventional detection requires two separate steps, which can cause long-lasting amplicon aerosol contaminants, hence leading to false-positive results. To address this problem, we proposed a one-tube assay based on CRISPR-Cas13a coupled with reverse transcription-recombinase polymerase amplification to avoid aerosol pollution. The one-tube assay could be completed within 40 min with a sensitivity of up to 180 copies of RNA per reaction, and exhibited no cross reactivity with two related coronaviruses. Our technology showed reproducibility with relative standard deviation of 4.6% responding to 1 fM nucleic acid for three times. It could be used to detect SARS-CoV-2 nucleic acids in raw wastewater with a limit of detection of 103 copies/mL. We also validated the practicability of this technique for viral detection in environmental water samples by detecting SARS-CoV-2 in wastewater, which were not detectable by RT-qPCR technology, showing resistance of this technology to wastewater matrix. It is anticipated that the robustness and high sensitivity will significantly promote the development of a point-of-care method in environmental virus monitoring.