RPB0431

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Influenza A virus Influenza A virus, FLUAV, Human Influenza A Virus, Influenza virus type A 11320 Articulavirales Orthomyxoviridae Alphainfluenzavirus Influenza A virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F TTATGACAAAGTCCGACTACAGCTTAGG 28 10 μM 42.86 57.73 8596.67 \
R CCTTTTTAATCTTGCTTCTTCTGAGTACTG 30 10 μM 36.67 55.19 9094.96 \

Gene Description

Target Gene GenBank ID
HA gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a convenient, efficient and accurate method to detect H5-AIV, and the results can be visualized and interpreted using LFD, RAA-CRISPR-Cas13a-LFD \ 40 min 37°C CRISPR-Cas13a-LFD 0.1 copy/μL 0.816 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Rapid detection of H5 subtype avian influenza virus using CRISPR Cas13a based-lateral flow dipstick Yang Li,Jiajing Shang,Juan Luo,Fuyou Zhang,Ge Meng,Yingjie Feng,Wenming Jiang,Xiaohui Yu,Chunran Deng,Guanhui Liu,Hualei Liu Frontiers in Microbiology 38094631 10.3389/fmicb.2023.1283210

Rapid detection of H5 subtype avian influenza virus using CRISPR Cas13a based-lateral flow dipstick

Author(s):

Yang Li,Jiajing Shang,Juan Luo,Fuyou Zhang,Ge Meng,Yingjie Feng,Wenming Jiang,Xiaohui Yu,Chunran Deng,Guanhui Liu,Hualei Liu

Journal:

Frontiers in Microbiology

Year:

2023

Abstract:

Due to its high mortality rate, highly pathogenic avian influenza (HPAI), a notifiable animal illness designated by the World Organisation for Animal Health (WOAH), has caused enormous financial losses to the poultry sector. The H5 subtype of avian influenza virus (H5-AIV) is regarded as the most common highly pathogenic avian influenza virus (HPAIV) that threatens public health and safety. Virus isolation and reverse transcription quantitative PCR (RT-qPCR) are usually used to detect H5-AIV and are important for the timely diagnosis and control of H5-AIV. However, these methods are time-consuming and require a significant amount of effort. In this study, we established a recombinase-aided amplification (RAA) combined with CRISPR-Cas13a and lateral flow dipstick (LFD) assay for the detection of H5-AIV. The results showed that the process can be completed within 40 min at 37°C. The method had a detection limit of 0.1 copy/μL, which was comparable to the RT-qPCR. There was no cross-reactivity with H3-AIV, H7-AIV, H9-AIV, H10-AIV, IBV, NDV, RVA and DAstV. The kappa value of RT-RAA-Cas13a-LFD and RT-qPCR in 380 clinical samples was 0.89 (κ>0.75). In conclusion, we established a convenient, efficient and accurate method to detect H5-AIV, and the results can be visualized and interpreted using LFD, which can be adapted to the needs of grassroots laboratories and field-deployable assays. This approach provides a new perspective for clinical H5-AIV diagnosis and has great potential for application in clinical quarantine of the poultry farming.