RPB0420

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Influenza A virus Influenza A virus, FLUAV, Human Influenza A Virus, Influenza virus type A 11320 Articulavirales Orthomyxoviridae Alphainfluenzavirus Influenza A virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F3 GTTCCAAAGAGAAAACGGACTGCGAGAGGC 30 10 μM 53.33 65.11 9323.13 \
R3 Biotin-CTTTTGTAATCTGCAGCAGTTCCCTCTC 28 10 μM 46.43 59.57 8456.54 \
P FAM-TTCATTGAAAATGGATGGGAAGGCCTAAT TG\THF\TGGTTGGTATGGTTTC[C3 Spacer] 47 10 μM 40.43 65.89 14649.55 \

Gene Description

Target Gene GenBank ID
HA \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
good specificity, sensitivity, stability and repeatability and may be used for rapid detection of AIV-H7 in clinical diagnosis RT-RAA-LFD Oligo 7 20 min 39°C LFD 1 × 10^0 copies/μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Development of a recombinase-aided amplification combined with a lateral flow dipstick assay for rapid detection of H7 subtype avian influenza virus Fuyou Zhang,Jiajing Shang,Juan Luo,Xin Yin,Xiaohui Yu,Wenming Jiang,Jinping Li,Liping Yuan,Guangyu Hou,Hualei Liu,Yang Li Frontiers in Microbiology 38029110 10.3389/fmicb.2023.1286713

Development of a recombinase-aided amplification combined with a lateral flow dipstick assay for rapid detection of H7 subtype avian influenza virus

Author(s):

Fuyou Zhang,Jiajing Shang,Juan Luo,Xin Yin,Xiaohui Yu,Wenming Jiang,Jinping Li,Liping Yuan,Guangyu Hou,Hualei Liu,Yang Li

Journal:

Frontiers in Microbiology

Year:

2023

Abstract:

Avian influenza viruses (AIV) pose a significant persistent threat to the public health and safety. It is estimated that there have been over 100 outbreaks caused by various H7 subtypes of avian influenza viruses (AIV-H7) worldwide, resulting in over 33 million deaths of poultry. In this study, we developed a recombinase-aided amplification combined with a lateral flow dipstick assay for the detection of hemagglutinin (HA) genes to provide technical support for rapid clinical detection of AIV-H7. The results showed that the assay can complete the reaction within 30 min at a temperature of 39°C. Specificity tests demonstrated that there was no cross-reactivity with other common poultry pathogens, including Newcastle disease virus (NDV) and infections bronchitis virus (IBV). The detection limit of this assay was 1 × 101 copies/μL, while RT-qPCR method was 1 × 101 copies/μL, and RT-PCR was 1 × 102 copies/μL. The κ value of the RT-RAA-LFD and RT-PCR assay in 132 avian clinical samples was 0.9169 (p < 0.001). These results indicated that the developed RT-RAA-LFD assay had good specificity, sensitivity, stability and repeatability and may be used for rapid detection of AIV-H7 in clinical diagnosis.