RPB0419

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
HAdV Human adenovirus 1907210 Rowavirales Adenoviridae Mastadenovirus Human adenovirus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
RF CATGCACATCGCCGGACAGGATGCTTCGGA 30 10 μM 60 70.14 9217.03 \
RR Biotin-TTTGTAAGAGTATGTATTGTCCTCCCGGTC 30 10 μM 43.33 59.22 9194.02 \
P FAM-TAGAAACCCCACAGTAGCGCCCACCCACGAT\THF\TGACCACCGACCGTAGC\C3-Spacer\ 48 10 μM 60.42 76.71 14590.52 \

Gene Description

Target Gene GenBank ID
AdvB AdvE \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
its rapidity, sensitivity, lack of contamination, and lack of requirements of high-precision instruments and skilled technicians. SV RPA \ 15 min 35°C \ 10 copies/μL 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 A Novel Sample-to-Answer Visual Nucleic Acid Detection System for Adenovirus Detection Kui Sun,Xiaodong Yang,Yanan Wang,Qun Guan,Wenliang Fu,Chao Zhang,Qin Liu,Wenzheng An,Yongqi Zhao,Weiwei Xing,Donggang Xu Microbiology Spectrum 37022182 10.1128/spectrum.05170-22

A Novel Sample-to-Answer Visual Nucleic Acid Detection System for Adenovirus Detection

Author(s):

Kui Sun,Xiaodong Yang,Yanan Wang,Qun Guan,Wenliang Fu,Chao Zhang,Qin Liu,Wenzheng An,Yongqi Zhao,Weiwei Xing,Donggang Xu

Journal:

Microbiology Spectrum

Year:

2023

Abstract:

Human adenoviruses (HAdVs) are common viruses that can cause local outbreaks in schools, communities and military camps, posing a huge threat to public health. An ideal POCT device for adenovirus detection in resource-limited settings is critical to control the spread of the virus. In this study, we developed an integrated and electricity-independent sample-to-answer system that can complete nucleic acid extraction, amplification, and detection at room temperature. This system is suitable for field and on-site detection because of its rapidity, sensitivity, lack of contamination, and lack of requirements of high-precision instruments and skilled technicians. It consists of two separate modules, ALP FINA (alkaline lysis with the paper-based filtration isolation of nucleic acid) and SV RPA (sealed and visual recombinase polymerase amplification). The extraction efficiency of ALP FINA can reach 48 to 84%, which is close to that of the conventional centrifuge column. The detection sensitivity of SV RPA is close to 10 copies/μL of AdvB and AdvE without aerosol contamination after repeated operations. When SV RPA was applied to the detection of nasopharyngeal swab samples of 19 patients who were infected with AdvB or AdvE as well as 10 healthy volunteers, its sensitivity and specificity reached 100%, respectively. IMPORTANCE HAdV infections are readily transmittable and, in some instances, highly contagious. Early and rapid diagnosis is essential for disease control. In this work, we developed a portable, disposable, and modularized sample-to-answer detection system for AdvB and AdvE, which rendered the entire test to be completely independent of electricity and other laboratory infrastructure. Thus, this detection system can be applied in resource-limited settings, and it has the potential to be further developed as an early diagnosis method in the field.