RPB0412

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Staphylococcus aureus Staphylococcus aureus, Micrococcus aureus, Staphylococcus pyogenes aureus 1280 Bacillales Staphylococcaceae Staphylococcus Staphylococcus aureus Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
RPA forward CGTGGACGTATTCGTATCGTCAATGATATGGCACTC 36 10 µm 47.22 64.02 11066.23 \
RPA reverse CACGTGCGATTAGACCTTCTTCTTCATTTAAATC 34 10 µm 38.24 58.62 10317.77 \
RPA exo AGATGCTTGGTATGGCGAAAGAAGACATCATCGGATAT\iBHQ-1dT\A\idSp\A\iFluorT\GTTAAGTGTATTAAG\3Phos\ 53 10 µm 37.74 64.58 16522.8 \

Gene Description

Target Gene GenBank ID
vicK gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a new application of the biphasic reaction in recombinase polymerase amplification (RPA), expanding the potential use of the technique in general nucleic acid amplification techniques. RPA-EXO \ 60min 37°C Exo Probe 1 CFU mL −1 \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 A Blood Drying Process for DNA Amplification Jongwon Lim,Shuaizhen Zhou,Janice Baek,Alicia Yeaeun Kim,Enrique Valera,Jonathan Sweedler,Rashid Bashir small 37888793 10.1002/smll.202307959

A Blood Drying Process for DNA Amplification

Author(s):

Jongwon Lim,Shuaizhen Zhou,Janice Baek,Alicia Yeaeun Kim,Enrique Valera,Jonathan Sweedler,Rashid Bashir

Journal:

small

Year:

2023

Abstract:

The presence of numerous inhibitors in blood makes their use in nucleic acid amplification techniques difficult. Current methods for extracting and purifying pathogenic DNA from blood involve removal of inhibitors, resulting in low and inconsistent DNA recovery rates. To address this issue, a biphasic method is developed that simultaneously achieves inhibitor inactivation and DNA amplification without the need for a purification step. Inhibitors are physically trapped in the solid-phase dried blood matrix by blood drying, while amplification reagents can move into the solid nano-porous dried blood and initiate the amplification. It is demonstrated that the biphasic method has significant improvement in detection limits for bacteria such as Escherichia coli, Methicillin-resistant Staphylococcus aureus, Methicillin-Sensitive Staphylococcus aureus using loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA). Several factors, such as drying time, sample volume, and material properties are characterized to increase sensitivity and expand the application of the biphasic assay to blood diagnostics. With further automation, this biphasic technique has the potential to be used as a diagnostic platform for the detection of pathogens eliminating lengthy culture steps.