RPB0406

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
RPA F2 AGGCAGCAGTAGGGGAACTTCTCCTGCTAGAAT 33 400 nM 51.52 66.82 10202.68 28870-28990
RPA R2 TTGGCCTTTACCAGACATTTTGCTCTCAAGCTG 33 400 nM 45.45 63.78 10045.57 28870-28990

Gene Description

Target Gene GenBank ID
N gene NC_045512.2

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapid and accurate diagnosis in resource-limited settings. RPA-Cas12 \ 20 min 37°C Cas12 0.6 cp/μL 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 A universal all-in-one RPA-Cas12a strategy with de novo autodesigner and its application in on-site ultrasensitive detection of DNA and RNA viruses Cailing Lin,Feng Chen,Dongchao Huang,Wenyan Li,Changsheng He,Yingjun Tang,Xueping Li,Can Liu,Liya Han,Yunpeng Yang,Yongchong Zhu,Ruikang Chen,Yuanju Shi,Chenglai Xia,Zhibin Yan,Hongli Du,Lizhen Huang Biosensors and Bioelectronics 37611446 10.1016/j.bios.2023.115609

A universal all-in-one RPA-Cas12a strategy with de novo autodesigner and its application in on-site ultrasensitive detection of DNA and RNA viruses

Author(s):

Cailing Lin,Feng Chen,Dongchao Huang,Wenyan Li,Changsheng He,Yingjun Tang,Xueping Li,Can Liu,Liya Han,Yunpeng Yang,Yongchong Zhu,Ruikang Chen,Yuanju Shi,Chenglai Xia,Zhibin Yan,Hongli Du,Lizhen Huang

Journal:

Biosensors and Bioelectronics

Year:

2023

Abstract:

Revolutionary all-in-one RPA-CRISPR assays are rapidly becoming the most sought-after tools for point-of-care testing (POCT) due to their high sensitivity and ease of use. Despite the availability of one-pot methods for specific targets, the development of more efficient methods for new targets remains a significant challenge. In this study, we present a rapid and universal approach to establishing an all-in-one RPA-Cas12a method CORDSv2 based on rational balancing amplification and Cas12a cleavage, which achieves ultrasensitive detection of several targets, including SARS-CoV-2, ASFV, HPV16, and HPV18. CORDSv2 demonstrates a limit of detection (LOD) of 0.6 cp/μL and 100% sensitivity for SARS-CoV-2, comparable to qPCR. Combining with our portable device(hippo-CORDS), it has a visual detection LOD of 6 cp/μL and a sensitivity up to 100% for SARS-CoV-2 and 97% for Ct<35 ASFV samples, surpassing most one-pot visual methods. To simplify and accelerate the process for new targets, we also develop a de novo autodesigner by which the optimal couples of primers and crRNA can be selected rapidly. As a universal all-in-one RPA-CRISPR method for on-site testing, CORDSv2 becomes an attractive choice for rapid and accurate diagnosis in resource-limited settings.