RPB0403

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Influenza A virus Influenza A virus, FLUAV, Human Influenza A Virus, Influenza virus type A 11320 Articulavirales Orthomyxoviridae Alphainfluenzavirus Influenza A virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
HA-F CCTGGTATTCGCTCTGATTGC 21 0.48 μM 52.38 56.16 6379.19 \
HA-R TAATACGACTCACTATAGGGAGGCACCGCATGTTTCCATTCT 42 0.48 μM 45.24 66.65 12848.4 \

Gene Description

Target Gene GenBank ID
HA \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
Our proposed MB-Associated Proteins 13a-chemiluminescence was further evaluated to test H7N9 clinical samples, showing superior sensitivity and specificity RT-RAA-Cas13a-MB-CL \ 30 min 25°C Cas13a-MB-CL 19.7 fM \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Clustered Regularly Interspaced Short Palindromic Repeats-Associated Proteins13a combined with magnetic beads, chemiluminescence and reverse transcription-recombinase aided amplification for detection of avian influenza a (H7N9) virus Hongpan Xu,Lijun Peng,Jie Wu,Adeel Khan,Yifan Sun,Han Shen,Zhiyang Li Frontiers in Bioengineering and Biotechnology 36686235 10.3389/fbioe.2022.1094028

Clustered Regularly Interspaced Short Palindromic Repeats-Associated Proteins13a combined with magnetic beads, chemiluminescence and reverse transcription-recombinase aided amplification for detection of avian influenza a (H7N9) virus

Author(s):

Hongpan Xu,Lijun Peng,Jie Wu,Adeel Khan,Yifan Sun,Han Shen,Zhiyang Li

Journal:

Frontiers in Bioengineering and Biotechnology

Year:

2023

Abstract:

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and Clustered Regularly Interspaced Short Palindromic Repeats-Associated Proteins (CRISPR-Cas) have promising prospects in the field of nucleic acid molecular diagnostics. However, Clustered Regularly Interspaced Short Palindromic Repeats-based fluorescence detection technology is mainly hindered by proteins with conjugated double bonds and autofluorescence, resulting in high fluorescence background, low sensitivity and incompatible reaction systems, which are not conducive to automatic clinical testing. Chemiluminescence (CL) detection technology has been applied mainly owing to its greatly high sensitivity, as well as low background and rapid response. Therefore, we developed a rapid, ultrasensitive and economical detection system based on Clustered Regularly Interspaced Short Palindromic Repeats-Clustered Regularly Interspaced Short Palindromic Repeats-Associated Proteins 13a combined with magnetic beads (MBs) and chemiluminescence (CL) (Cas13a-MB-CL) to detect Influenza A (H7N9), an acute respiratory tract infectious disease. The carboxyl functionalized magnetic beads (MBs-COOH) were covalently coupled with aminated RNA probe while the other end of the RNA probe was modified with biotin. Alkaline phosphatase labeled streptavidin (SA-ALP) binds with biotin to form magnetic beads composites. In presence of target RNA, the collateral cleavage activity of Cas13a was activated to degrade the RNA probes on MBs and released Alkaline phosphatase from the composites. The composites were then magnetically separated followed by addition of ALP substrate Disodium 2-chloro-5-{4-methoxyspiro [1,2-dioxetane-3,2'-(5'-chloro) tricyclo (3.3.1.13,7) decan]-4-yl}-1-phenyl phosphate (CDP-star), to generate the chemiluminescence signal. The activity of Associated Proteins 13a and presence of target RNA was quantified by measuring the chemiluminescence intensity. The proposed method accomplished the detection of H7N9 within 30 min at 25°C. When combined with Reverse Transcription- Recombinase Aides Amplification (RT-RAA), the low detection limit limit of detection was as low as 19.7 fM (3S/N). Our proposed MB-Associated Proteins 13a-chemiluminescence was further evaluated to test H7N9 clinical samples, showing superior sensitivity and specificity.