RPB0401

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Human bocavirus 1 Human bocavirus 1,Human bocaparvovirus 1,Human bocavirus type 1 689403 Piccovirales Parvoviridae Bocaparvovirus Bocaparvovirus primate1 Viruses

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
HBoV1-F CTGGCAGACAACTCATCACAGGAGCAGGAG 30 10 μM 56.67 66.35 9259.08 2490-2829
HBoV1-R CATTATCAATTTGTAGCTGTTGAAACTGTT 30 10 μM 30 53.49 9201.06 2490-2829
HBoV1-probe GACACAATGGGGAGAGAGGCTCGGGCTCAT(ROX)(THF)T(BHQ1)CATCAGGAACACCC-block 44 10 μM 59.09 74.07 13609.88 2490-2829

Gene Description

Target Gene GenBank ID
NP1 JN632495.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ RPA-CRISPR\Cas12 \ 40 min 37°C CRISPR\Cas12 0.5 copies \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Development of RPA-Cas12a-fluorescence assay for rapid and reliable detection of human bocavirus 1 Weidong Qian,Xuefei Wang,Ting Wang,Jie Huang,Qian Zhang,Yongdong Li,Si Chen Animal Models and Experimental Medicine 36794352 10.1002/ame2.12298

Development of RPA-Cas12a-fluorescence assay for rapid and reliable detection of human bocavirus 1

Author(s):

Weidong Qian,Xuefei Wang,Ting Wang,Jie Huang,Qian Zhang,Yongdong Li,Si Chen

Journal:

Animal Models and Experimental Medicine

Year:

2024

Abstract:

Human bocavirus (HBoV) 1 is considered an important pathogen that mainly affects infants aged 6-24 months, but preventing viral transmission in resource-limited regions through rapid and affordable on-site diagnosis of individuals with early infection of HBoV1 remains somewhat challenging. Herein, we present a novel faster, lower cost, reliable method for the detection of HBoV1, which integrates a recombinase polymerase amplification (RPA) assay with the CRISPR/Cas12a system, designated the RPA-Cas12a-fluorescence assay. The RPA-Cas12a-fluorescence system can specifically detect target gene levels as low as 0.5 copies of HBoV1 plasmid DNA per microliter within 40 min at 37°C without the need for sophisticated instruments. The method also demonstrates excellent specificity without cross-reactivity to non-target pathogens. Furthermore, the method was appraised using 28 clinical samples, and displayed high accuracy with positive and negative predictive agreement of 90.9% and 100%, respectively. Therefore, our proposed rapid and sensitive HBoV1 detection method, the RPA-Cas12a-fluorescence assay, shows promising potential for early on-site diagnosis of HBoV1 infection in the fields of public health and health care. The established RPA-Cas12a-fluorescence assay is rapid and reliable method for human bocavirus 1 detection. The RPA-Cas12a-fluorescence assay can be completed within 40 min with robust specificity and sensitivity of 0.5 copies/μl.