RPB0398

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Mycobacterium tuberculosis Mycobacterium tuberculosis, Bacterium tuberculosis, Bacillus tuberculosis, Mycobacterium tuberculosis variant tuberculosis 1773 Corynebacteriales Mycobacteriaceae Mycobacterium Mycobacterium tuberculosis Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F CCAAGCTGCGCCAGGGCAGCTATTTCCCGGAC 32 0.4µmol\L 65.63 73.84 9771.37 2,841,720–2,842,968
R TTGGCCATGATCGACACTTGCGACTTGGA 29 0.4µmol\L 51.72 65.92 8908.83 2,841,720–2,842,968

Gene Description

Target Gene GenBank ID
IS1081 CP016972.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
an economical, efficient, and simple platform for grassroots laboratories and field detection. RAA-CRISPR\Cas12 \ 30 min 37°C CRISPR\Cas12 3.13 CFU\mL 0.883 0.94

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 A new method for the detection of Mycobacterium tuberculosis based on the CRISPR\Cas system Xiaoyu Zhang,Xiaoying He,Yubo Zhang,Lei Chen,Zhaobao Pan,Yueying Huang,Heng Li BMC Infectious Diseases 37821806 10.1186/s12879-023-08656-4

A new method for the detection of Mycobacterium tuberculosis based on the CRISPR\Cas system

Author(s):

Xiaoyu Zhang,Xiaoying He,Yubo Zhang,Lei Chen,Zhaobao Pan,Yueying Huang,Heng Li

Journal:

BMC Infectious Diseases

Year:

2023

Abstract:

Object: Mycobacterium tuberculosis (MTB) is a bacterium that can cause zoonoses by aerosol transmission. Tuberculosis (TB) caused by MTB heavily burdens world public health security. Developing efficient, specific, convenient, and inexpensive MTB assays are essential for preventing and controlling TB. Methods: In this study, we established a specific detection method for MTB using the Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) system, combined with recombinase mediated isothermal nucleic acid amplification (RAA) to improve the sensitivity of the detection system and achieve "two-level" amplification of the detection signal. The sensitivity and specificity of RAA combined with the CRISPR/Cas system were analyzed. Using BACTEC 960 culture as the gold standard for detecting MTB, we established the TB-CRISPR technique by testing 504 samples from patients with suspected TB. Results: MTB H37Ra could be seen as low as 3.13 CFU/mL by the CRISPR-Cas12a system targeting IS6110. With BACTEC960 culture (120 positives and 384 negatives) as the gold standard, the sensitivity of the TB-CRISPR technique was 0.883 (0.809-0.932), and the specificity was 0.940 (0.910-0.961). According to the receiver operating characteristic (ROC) curve analysis, the area under the curve (AUC) reached 0.944 (0.914-0.975) within 95% CI. The positive likelihood ratio (PLR) was 14.747 (9.870-22.035), and the negative likelihood ratio (NLR) was 0.124 (0.076-0.203). The positive predictive value (PPV) was 0.822 (0.742-0.881), and the negative predictive value (NPV) was 0.963 (0.937-0.979). Conclusion: TB-CRISPR plays an essential role in the molecular diagnosis of TB. The whole detection time is less than 1.5 h. It is easy to operate and does not need complex instruments. It is of great significance for the rapid detection of MTB and the clinical diagnosis of TB.