RPB0394

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
E fwd GAGACGGGCGACAGATATGTACTCATTCGTTTC 33 480 nM 48.48 63.17 10168.66 \
E rev GGTCCAGAACTGATTTAGACCAGAAGATCAG 31 480 nM 45.16 59.83 9577.3 \

Gene Description

Target Gene GenBank ID
E gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
high sensitivity, specificity, and cost-effectiveness, which are crucial in the management of the ongoing COVID-19 pandemic. RPA- CRISPR \ 20 min 37 °C CRISPR 20 copies \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Multiplex solid-phase RPA coupled CRISPR-based visual detection of SARS-CoV-2 Xiaochen Qin,Ratul Paul,Yuyuan Zhou,Yue Wu,Xuanhong Cheng,Yaling Liu Biosens Bioelectron X 38293281 10.1016/j.biosx.2023.100381

Multiplex solid-phase RPA coupled CRISPR-based visual detection of SARS-CoV-2

Author(s):

Xiaochen Qin,Ratul Paul,Yuyuan Zhou,Yue Wu,Xuanhong Cheng,Yaling Liu

Journal:

Biosens Bioelectron X

Year:

2023

Abstract:

The COVID-19 pandemic has presented a significant challenge to the world's public health and led to over 6.9 million deaths reported to date. A rapid, sensitive, and cost-effective point-of-care virus detection device is essential for the control and surveillance of the contagious severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) pandemic. The study presented here aimed to demonstrate a solid-phase isothermal recombinase polymerase amplification coupled CRISPR-based (spRPA-CRISPR) assay for on-chip multiplexed, sensitive and visual COVID-19 DNA detection. The assay targets the SARS-CoV-2 structure protein encoded genomes and can simultaneously detect two specific genes without cross-interaction. The amplified target sequences were immobilized on the one-pot device surface and detected using the mixed Cas12a-crRNA collateral cleavage of reporter-released fluorescent signal when specific genes were recognized. The endpoint signal can be directly visualized for rapid detection of COVID-19. The system was tested with samples of a broad range of concentrations (20 to 2 × 104 copies) and showed analytical sensitivity down to 20 copies per microliter. Furthermore, a low-cost blue LED flashlight (~$12) was used to provide a visible SARS-CoV-2 detection signal of the spRPA-CRISPR assay which could be purchased online easily. Thus, our platform provides a sensitive and easy-to-read multiplexed gene detection method that can specifically identify low concentration genes.