RPB0384

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Nipah virus Nipah henipavirus 121791 Mononegavirales Paramyxoviridae Henipavirus Nipah virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
RPA-F GAAATTAATACGACTCACTATAGGGTCAAGAGGAGATGGAAGGCTTGATGA 51 120 nM 41.18 65.57 15908.41 \
RPA-R ACGTACTTAGCCCATCTTCTAGTTTCA 27 120 nM 40.74 56.82 8160.37 \

Gene Description

Target Gene GenBank ID
N gene AY988601.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
he assay was then validated with simulated clinical samples. The results for the one-pot RPA-CRISPR\Cas13a assay could be visualized with either fluorescence or lateral flow strips for convenient clinical or field diagnostics, providing a useful supplement to the gold-standard qRT-PCR assay for detecting NiV detections RPA-CRISPR\Cas13a MEGA (Version: 11.0.13) 2h 37°C CRISPR\Cas13a 10³ cp/μL 0.95 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Rapid detection of Nipah virus using the one-pot RPA-CRISPR\Cas13a assay Jing Miao,Lulu Zuo,Dongmei He,Zhixin Fang,Nicolas Berthet,Chao Yu,Gary Wong Virus Research 37178792 10.1016/j.virusres.2023.199130

Rapid detection of Nipah virus using the one-pot RPA-CRISPR\Cas13a assay

Author(s):

Jing Miao,Lulu Zuo,Dongmei He,Zhixin Fang,Nicolas Berthet,Chao Yu,Gary Wong

Journal:

Virus Research

Year:

2023

Abstract:

Nipah virus (NiV) is a zoonotic pathogen with airborne transmission and high case fatality rates in humans. There is currently no treatment or vaccine against NiV infection approved for humans or animals, therefore early diagnosis is the key to control any potential outbreaks. In this study, we developed an optimized one-pot assay using recombinase polymerase amplification (RPA) coupled to CRISPR/Cas13a for the molecular detection of NiV. The one-pot RPA-CRISPR/Cas13a assay for NiV detection was specific and did not cross-react against other selected (re)-emerging pathogens. The sensitivity of the one-pot RPA-CRISPR/Cas13a assay for NiV detection can detect as little as 103 cp/μL of total synthetic NiV cDNA. The assay was then validated with simulated clinical samples. The results for the one-pot RPA-CRISPR/Cas13a assay could be visualized with either fluorescence or lateral flow strips for convenient clinical or field diagnostics, providing a useful supplement to the gold-standard qRT-PCR assay for detecting NiV detections.