RPB0382

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Influenza A virus Influenza A virus, FLUAV, Human Influenza A Virus, Influenza virus type A 11320 Articulavirales Orthomyxoviridae Alphainfluenzavirus Influenza A virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
H3F CACAGTATCTACCAAAAGAAGCCAACAAG 29 20 μM 41.38 57.46 8865.88 \
H3R GTGCATCTGATCTCATTATTGAGCTTTTCC 30 20 μM 40 57.49 9128.98 \

Gene Description

Target Gene GenBank ID
HA \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a seldom detection method with rapid,sensitive, specific, and instrument-free characteristics. RPA-CRISPR\Cas12a \ 30 min 37°C CRISPR-Cas12a 2 copies/reaction \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Infectious Disease Diagnosis and Pathogen Identification Platform Based on Multiplex Recombinase Polymerase Amplification-Assisted CRISPR-Cas12a System Ziqin Lin,Baochang Sun,Xi Yang,Yayun Jiang,Sihong Wu,Binbin Lv,Yajing Pan,Qingxun Zhang,Xiaoqiong Wang,Guangxin Xiang,Yongliang Lou,Xingxing Xiao ACS Infectious Diseases 37811564 10.1021/acsinfecdis.3c00381

Infectious Disease Diagnosis and Pathogen Identification Platform Based on Multiplex Recombinase Polymerase Amplification-Assisted CRISPR-Cas12a System

Author(s):

Ziqin Lin,Baochang Sun,Xi Yang,Yayun Jiang,Sihong Wu,Binbin Lv,Yajing Pan,Qingxun Zhang,Xiaoqiong Wang,Guangxin Xiang,Yongliang Lou,Xingxing Xiao

Journal:

ACS Infectious Diseases

Year:

2023

Abstract:

Controlling and mitigating infectious diseases caused by multiple pathogens or pathogens with several subtypes require multiplex nucleic acid detection platforms that can detect several target genes rapidly, specifically, sensitively, and simultaneously. Here, we develop a detection platform, termed Multiplex Assay of RPA and Collateral Effect of Cas12a-based System (MARPLES), based on multiplex nucleic acid amplification and Cas12a ssDNase activation to diagnose these diseases and identify their pathogens. We use the clinical specimens of hand, foot, and mouth disease (HFMD) and influenza A to evaluate the feasibility of MARPLES in diagnosing the disease and identifying the pathogen, respectively, and find that MARPLES can accurately diagnose the HFMD associated with enterovirus 71, coxsackievirus A16 (CVA16), CVA6, or CVA10 and identify the exact types of H1N1 and H3N2 in an hour, showing high sensitivity and specificity and 100% predictive agreement with qRT-PCR. Collectively, our findings demonstrate that MARPLES is a promising multiplex nucleic acid detection platform for disease diagnosis and pathogen identification.