RPB0375

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Klebsiella pneumoniae Klebsiella pneumoniae, Bacillus pneumoniae, Hyalococcus pneumoniae 573 Enterobacterales Enterobacteriaceae Klebsiella Klebsiella pneumoniae Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
F CAATTCGGCTAACATTTTTCTTTAAGAATGC 31 \ 32.26 54.81 9459.23 \
R TATTCAGGGAAATGGGGAGGGTACAAAATG 30 \ 43.33 60.04 9408.19 \
P GCATGTTAACATAGATGTCATAATCACACCC[FAM-dt][THF] [BHQ1-dt]AGGATAAAACCGCCC[3′-block] 46 \ 43.48 66.07 14064.23 \

Gene Description

Target Gene GenBank ID
rmpA gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a rapid, sensitive, and convenient assay for hvKp detection. RAA \ 20 min 39°C \ 20 copies/reaction 1 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Recombinase-Aided Amplification Assay for Rapid Detection of Hypervirulent Klebsiella pneumoniae (hvKp) and Characterization of the hvKp Pathotype Chao Yan,Yao Zhou,Shuheng Du,Bing Du,Hanqing Zhao,Yanling Feng,Guanhua Xue,Jinghua Cui,Lin Gan,Junxia Feng,Zheng Fan,Tongtong Fu,Ziying Xu,Qun Zhang,Rui Zhang,Xiaohu Cui,Ziyan Tian,Yujie Chen,Ting Zhang,Lei Huang,Jing Yuan Microbiology Spectrum 36912637 10.1128/spectrum.03984-22

Recombinase-Aided Amplification Assay for Rapid Detection of Hypervirulent Klebsiella pneumoniae (hvKp) and Characterization of the hvKp Pathotype

Author(s):

Chao Yan,Yao Zhou,Shuheng Du,Bing Du,Hanqing Zhao,Yanling Feng,Guanhua Xue,Jinghua Cui,Lin Gan,Junxia Feng,Zheng Fan,Tongtong Fu,Ziying Xu,Qun Zhang,Rui Zhang,Xiaohu Cui,Ziyan Tian,Yujie Chen,Ting Zhang,Lei Huang,Jing Yuan

Journal:

Microbiology Spectrum

Year:

2023

Abstract:

Hypervirulent Klebsiella pneumoniae (hvKp) is a major human pathogen associated with liver abscess, pneumonia, meningitis, and endophthalmitis. It is challenging to differentiate hvKp from classical Klebsiella pneumoniae (cKp) using conventional methods, necessitating the development of a rapid, sensitive, and convenient assay for hvKp detection. In this study, we constructed a recombinase-aided amplification (RAA) method targeting hvKp genes peg344 and rmpA, and also analyzed the pathogenic characteristics of hvKp. We optimized the reaction temperature and system, and evaluated its sensitivity, specificity, and clinical application. The primer and probe sets peg344-set1 and rmpA-set2 delivered significant fluorescent signals at 39°C with the shortest gene amplification times (sensitivity: 20 copies/reaction). This RAA assay showed no cross-reactivity with 15 other common pathogenic bacteria. Its applicability was confirmed by the evaluation of 208 clinical specimens, of which 45 were confirmed to be hvKp. The sensitivity and specificity of the RAA assay were both 100% compared with real-time PCR as the reference standard. To verify the assay, we also assessed the diversity of molecular characteristics among the hvKp isolates and identified serotype K1 and sequence type ST23 as the dominant clone. Virulence factors iroN and iutA were highly associated with virulence level. In conclusion, our novel RAA assay is a powerful tool for early diagnosis and epidemiological surveillance of hvKp. IMPORTANCEKlebsiella pneumoniae is the most common opportunistic bacterial species and a major threat to public health. Since the 1990s, hvKp has received increasing attention from public health officials and infectious disease specialists. Hypervirulent strains differ from classical strains in terms of phenotypic features and clinical outcomes. It is hard to identify hvKp from cKp using the conventional methods including colony morphology analysis, serum killing assays, mouse lethality assays, string tests, and real-time PCR. In this study, we established a rapid, sensitive and convenient recombinase-aided amplification assay for hvKp detection targeting virulence genes peg344 and rmpA. Our RAA assay provides an important tool for the rapid diagnosis of infectious diseases caused by hvKp, particularly in primary laboratories.