RPB0366

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Pseudomonas aeruginosa Pseudomonas aeruginosa, Bacterium aeruginosum, Bacillus aeruginosus 287 Pseudomonadales Pseudomonadaceae Pseudomonas Pseudomonas aeruginosa Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
RPA-Forward CAATATGGAGACCGTTTTCAGGTATTTCAAG 31 0.5 μM 38.71 57.14 9549.28 \
RPA-Reverse TGACTTGCATGCAGGATTACCGTCTATTAGAGC 33 0.5 μM 45.45 62.68 10143.64 \

Gene Description

Target Gene GenBank ID
\ \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
rapid and sensitive with low cost, which shows good quality to be adopted as a point-of-care testing method. RPA-Cas12a-RCFL \ 20 min 42 °C Cas12a-RCFL 50 CFU\mL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Rapid and sensitive detection of Pseudomonas aeruginosa by isothermal amplification combined with Cas12a-mediated detection Siyi Huang,Xianfeng Wang,Xinchong Chen,Xiaoyu Liu,Qiuqing Xu,Lijun Zhang,Guangtao Huang,Jun Wu Scientific Reports 37932335 10.1038/s41598-023-45766-0

Rapid and sensitive detection of Pseudomonas aeruginosa by isothermal amplification combined with Cas12a-mediated detection

Author(s):

Siyi Huang,Xianfeng Wang,Xinchong Chen,Xiaoyu Liu,Qiuqing Xu,Lijun Zhang,Guangtao Huang,Jun Wu

Journal:

Scientific Reports

Year:

2023

Abstract:

CRISPR based technologies have been used for fast and sensitive detection of pathogens. To test the possibility of CRISPR based detection strategy in Pseudomonas aeruginosa infections, a combined method of recombinase polymerase amplification followed by Cas12a-mediated detection via fluorescence reader or lateral flow biosensor (named Cas12a-RCFL) has been established in this study. The Cas12a-RCFL can detect as low as 50 CFU/mL Pseudomonas aeruginosa. The whole detection process can be finished within one hour with satisfied detection specificity. Cas12a-RCFL also shows good sensitivity of detecting Pseudomonas aeruginosa inStaphylococcus aureus and Acinetobacter baumannii contaminated samples. For the detection of 22 clinical samples, Cas12a-RCFL matches with PCR sequencing result exactly without DNA purification. This Cas12a-RCFL is rapid and sensitive with low cost, which shows good quality to be adopted as a point-of-care testing method.