RPB0365

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Mycobacterium tuberculosis H37Rv Mycobacterium tuberculosis H37Rv, Mycobacterium tuberculosis str. H37Rv, Mycobacterium tuberculosis strain H37Rv 83332 Corynebacteriales Mycobacteriaceae Mycobacterium Mycobacterium tuberculosis Bacterium

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F GGTCCGAAACGCCTCTACGGCTTCGTCGAGCTCTTT 36 10 µM 58.33 71.52 10979.15 870–905
R TGGCGACCTGCTACCTGCTGGGAGTATCCAC 31 10 µM 61.29 70.54 9488.19 979–1009
P GCCATGATCGACACTTGCGACTTGGAAAGC(FAM-dT)(THF)(BHQ1-dT)GTCACACCAAGTGTT[C3-spacer] 45 10 µM 51.11 71.43 13830.02 907–954

Gene Description

Target Gene GenBank ID
IS1081 gene AL123456.3

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a convenient, sensitive, and low-cost diagnostic tool for the rapid detection of MTB. RAA SnapGene Software(Version 4.3.6) 30 min 42 °C \ 163 copies 0.725 0.951

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 Real-time recombinase-aided amplification assay for rapid amplification of the IS1081 gene of Mycobacterium tuberculosis Yuanyuan Liu,Weicong Ren,Zhongtan Xue,Yuedong Miao,Wei Wang,Xuxia Zhang,Cong Yao,Yuanyuan Shang,Shanshan Li,Fengling Mi,Yu Pang European Journal of Clinical Microbiology & Infectious Diseases 37256455 10.1007/s10096-023-04626-5

Real-time recombinase-aided amplification assay for rapid amplification of the IS1081 gene of Mycobacterium tuberculosis

Author(s):

Yuanyuan Liu,Weicong Ren,Zhongtan Xue,Yuedong Miao,Wei Wang,Xuxia Zhang,Cong Yao,Yuanyuan Shang,Shanshan Li,Fengling Mi,Yu Pang

Journal:

European Journal of Clinical Microbiology & Infectious Diseases

Year:

2023

Abstract:

Mycobacterium tuberculosis (MTB), the etiological agent of tuberculosis (TB), is the leading cause of death due to a single infectious agent worldwide. Rapid and accurate diagnosis of MTB is critical for controlling TB especially in resource-limited countries, since any diagnosis delay increases the chances of transmission. Here, a real-time recombinase-aided amplification (RAA) assay targeting conserved positions in IS1081 gene of MTB, is successfully established to detect MTB. The intact workflow was completed within 30 min at 42 °C with no cross-reactivity observed for non-tuberculous mycobacteria and other clinical bacteria, and the detection limit for recombinant plasmid of MTB IS1081 was 163 copies/reaction at 95% probability, which was approximately 1.5-fold increase in analytical sensitivity for the detection of MTB, compared to conventional quantitative real-time PCR (qPCR; 244 copies/reaction). Furthermore, the result of clinical performance evaluation revealed an increased sensitivity of RAA assay relative to qPCR was majorly noted in the specimens with low bacteria loads. Our results demonstrate that the developed real-time RAA assay is a convenient, sensitive, and low-cost diagnostic tool for the rapid detection of MTB.