RPB0357

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
U-RPA-F GGACATCCATGCAAATGTTACAAGCAGAAAGAG 33 0.42 μM 42.42 61.02 10212.73 \
U-RPA-R TGCTATGTTCTCTCTCACTTCCCCTTGGATCTGGC 35 0.42 μM 51.43 66.81 10581.89 \

Gene Description

Target Gene GenBank ID
RNase P gene NC_045512.2

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
This FARPA is very suitable for pathogen screening and discrimination of viral variants, greatly facilitating point-of-care diagnostics FARPA \ 30 min 37°C FEN1（ flap endonuclease 1） 20 copies per mL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2023 FEN1-aided recombinase polymerase amplification (FARPA) for one-pot and multiplex detection of nucleic acids with an ultra-high specificity and sensitivity Yi Ma,Haiping Wu,Shan Chen,Chunmei Xie,Jingjing Hu,Xiemin Qi,Xueping Ma,Yanan Chu,Jingwen Shan,Yan Lu,Lunbiao Cui,Bingjie Zou,Guohua Zhou Biosensors and Bioelectronics 37354713 10.1016/j.bios.2023.115456

FEN1-aided recombinase polymerase amplification (FARPA) for one-pot and multiplex detection of nucleic acids with an ultra-high specificity and sensitivity

Author(s):

Yi Ma,Haiping Wu,Shan Chen,Chunmei Xie,Jingjing Hu,Xiemin Qi,Xueping Ma,Yanan Chu,Jingwen Shan,Yan Lu,Lunbiao Cui,Bingjie Zou,Guohua Zhou

Journal:

Biosensors and Bioelectronics

Year:

2023

Abstract:

Recombinase polymerase amplification (RPA) running at 37-42 °C is fast, efficient and less-implemented; however, the existing technologies of nucleic acid testing based on RPA have some limitations in specificity of single-base recognition and multiplexing capability. Herein, we report a highly specific and multiplex RPA-based nucleic acid detection platform by combining flap endonuclease 1 (FEN1)-catalysed invasive reactions with RPA, termed as FEN1-aided RPA (FARPA). The optimal conditions enable RPA and FEN1-based fluorescence detection to occur automatically and sequentially within a 25-min turnaround time and FARPA exhibits sensitivity to 5 target molecules. Due to the ability of invasive reactions in discriminating single-base variation, this one-pot FARPA is much more specific than the Exo probe-based or CRISPR-based RPA methods. Using a universal primer pair derived from tags in reverse transcription primers, multiplex FARPA was successfully demonstrated by the 3-plex assay for the detection of SARS-CoV-2 pathogen (the ORF1ab, the N gene, and the human RNase P gene as the internal control), the 2-plex assay for the discrimination of SARS-CoV-2 wild-type from variants (Alpha, Beta, Epsilon, Delta, or Omicrons), and the 4-plex assay for the screening of arboviruses (zika virus, tick-borne encephalitis virus, yellow fever virus, and chikungunya virus). We have validated multiplex FARPA with 103 nasopharyngeal swabs for SARS-CoV-2 detection. The results showed a 100% agreement with RT-qPCR assays. Moreover, a hand-held FARPA analyser was constructed for the visualized FARPA due to the switch-like endpoint read-out. This FARPA is very suitable for pathogen screening and discrimination of viral variants, greatly facilitating point-of-care diagnostics.