RPB0349

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Aspergillus fumigatus Aspergillus fumigatus, Sartorya fumigata, Neosartorya fumigata 746128 Eurotiales Aspergillaceae Aspergillus Aspergillus fumigatus Fungus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
F1 GCTCTCCCTGGATAGAAGAACCCCACTTGT 30 10 μM 53.33 65.14 9126.98 \
R1 GGTTACCCTGTCACCAAGAATCAAGTTTAG 30 10 μM 43.33 58.86 9190.05 \

Gene Description

Target Gene GenBank ID
Beta-tubulin gene AY048754

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
pid, highly sensitive, and specific detection method that circumvents the reliance on complex and costly equipment. RPA-CRISPR\Cas12a-LFs Primer Premier 5.0 20 min 37 °C CRISPR\Cas12a-LFs 10² copies/μL 0.967 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Establishing a pulmonary aspergillus fumigatus infection diagnostic platform based on RPA-CRISPR-Cas12a Chunhui Lin,Jing Zhou,Nana Gao,Runde Liu,Ge Li,Jinyu Wang,Guoping Lu,Jilu Shen World Journal of Microbiology and Biotechnology 38418617 10.1007/s11274-024-03940-0

Establishing a pulmonary aspergillus fumigatus infection diagnostic platform based on RPA-CRISPR-Cas12a

Author(s):

Chunhui Lin,Jing Zhou,Nana Gao,Runde Liu,Ge Li,Jinyu Wang,Guoping Lu,Jilu Shen

Journal:

World Journal of Microbiology and Biotechnology

Year:

2024

Abstract:

In this study, we devised a diagnostic platform harnessing a combination of recombinase polymerase amplification (RPA) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas12a system. Notably, this platform obviates the need for intricate equipment and finds utility in diverse settings. Two result display methods were incorporated in this investigation: the RPA-Cas12a-fluorescence method and the RPA-Cas12a-LFS (lateral flow strip). Upon validation, both display platforms exhibited no instances of cross-reactivity, with seven additional types of fungal pathogens responsible for respiratory infections. The established detection limit was ascertained to be as low as 102 copies/µL. In comparison to fluorescence quantitative PCR, the platform demonstrated a sensitivity of 96.7%, a specificity of 100%, and a consistency rate of 98.0%.This platform provides expeditious, precise, and on-site detection capabilities, thereby rendering it a pivotal diagnostic instrument amenable for deployment in primary healthcare facilities and point-of-care settings.