RPB0348

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
HRSV B Human respiratory syncytial virus B, Respiratory syncytial virus group B 208895 Mononegavirales Pneumoviridae Orthopneumovirus Human orthopneumovirus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM) GC Content(%) Predicted Melting Temperature(℃) Molecular Weight(g/moles) Positions in GenBank accession number
HRSVBF AGGCTATGGCAAGACTTAGGAATGAGG 27 10 μM 48.15 60.22 8437.55 2853–3107
HRSVBR TGGTGGTTCTGCTGACGGACGTTTA 25 10 μM 52 62.73 7735.06 2853–3107
PorbeB BHQ2-CACGACCTGTTGCTGAGTGAGTTGAGACAC-ROX 30 10 μM 53.33 64.65 9247.06 2853–3107

Gene Description

Target Gene GenBank ID
\ MG642066.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
\ RT-RPA- Pf Ago Primer Premier 5.0 30 min 39°C Pf Ago 1 copy/μL 0.9535 0.9813

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 RT-RPA- Pf Ago detection platform for one-tube simultaneous typing diagnosis of human respiratory syncytial virus Jia-Yu Liao,Xue-Yong Feng,Jie-Xiu Zhang,Tian-Dan Yang,Min-Xuan Zhan,Yong-Mei Zeng,Wei-Yi Huang,Hao-Bin Lian,Lin Ke,Si-Si Cai,Nan-Fei Zhang,Jin-Wen Fang,Xiao-Ying Cai,Jun-Duo Chen,Guang-Yu Lin,Li-Yun Lin,Wei-Zhong Chen,Yu-Yan Liu,Fei-Fei Huang,Chuang-Xing Lin,Min Lin Front. Cell. Infect. Microbiol. 39119294 10.3389/fcimb.2024.1419949

RT-RPA- Pf Ago detection platform for one-tube simultaneous typing diagnosis of human respiratory syncytial virus

Author(s):

Jia-Yu Liao,Xue-Yong Feng,Jie-Xiu Zhang,Tian-Dan Yang,Min-Xuan Zhan,Yong-Mei Zeng,Wei-Yi Huang,Hao-Bin Lian,Lin Ke,Si-Si Cai,Nan-Fei Zhang,Jin-Wen Fang,Xiao-Ying Cai,Jun-Duo Chen,Guang-Yu Lin,Li-Yun Lin,Wei-Zhong Chen,Yu-Yan Liu,Fei-Fei Huang,Chuang-Xing Lin,Min Lin

Journal:

Front. Cell. Infect. Microbiol.

Year:

2024

Abstract:

Human respiratory syncytial virus (HRSV) is the most prevalent pathogen contributing to acute respiratory tract infections (ARTI) in infants and young children and can lead to significant financial and medical costs. Here, we developed a simultaneous, dual-gene and ultrasensitive detection system for typing HRSV within 60 minutes that needs only minimum laboratory support. Briefly, multiplex integrating reverse transcription-recombinase polymerase amplification (RT-RPA) was performed with viral RNA extracted from nasopharyngeal swabs as a template for the amplification of the specific regions of subtypes A (HRSVA) and B (HRSVB) of HRSV. Next, the Pyrococcus furiosus Argonaute (PfAgo) protein utilizes small 5'-phosphorylated DNA guides to cleave target sequences and produce fluorophore signals (FAM and ROX). Compared with the traditional gold standard (RT-qPCR) and direct immunofluorescence assay (DFA), this method has the additional advantages of easy operation, efficiency and sensitivity, with a limit of detection (LOD) of 1 copy/μL. In terms of clinical sample validation, the diagnostic accuracy of the method for determining the HRSVA and HRSVB infection was greater than 95%. This technique provides a reliable point-of-care (POC) testing for the diagnosis of HRSV-induced ARTI in children and for outbreak management, especially in resource-limited settings.