RPB0346

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
Influenza A virus Influenza A virus, FLUAV, Human Influenza A Virus, Influenza virus type A 11320 Articulavirales Orthomyxoviridae Alphainfluenzavirus Influenza A virus Virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
H9-RF-F TCAGCGAGGTTGAAACTAGACTTAACATGATC 32 10 µM 40.63 59.24 9856.49 1223–1254
H9-RF-R CTTTCCCATCTTCCACCGCATTGGAACCCAATG 33 10 µM 51.52 66.35 9944.51 1388–1420
H9-RF-T CACTCGATGAGCATGATGCAAATGTAAACAA\i6FAMdT\C\idSp\A\iBHQ1dT\ATAATAAAGTGAAGA\C3-spacer\ 46 10 µM 32.61 60.92 14264.4 1334–1384

Gene Description

Target Gene GenBank ID
HA gene KP865956.1

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
quick response, simple operation, strong specificity, high sensitivity, good repeatability, and stability. RF-RT-RAA \ 17 min 39 °C exo probe 10¹ copies/μL \ \

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Detection method for reverse transcription recombinase-aided amplification of avian influenza virus subtypes H5, H7, and H9 Zongshu Zhang,Zichuang Zhang,Chunguang Wang,Xianghe Zhai,Wenjing Wang,Xi Chen,Tie Zhang BMC Veterinary Research 38755641 10.1186/s12917-024-04040-9

Detection method for reverse transcription recombinase-aided amplification of avian influenza virus subtypes H5, H7, and H9

Author(s):

Zongshu Zhang,Zichuang Zhang,Chunguang Wang,Xianghe Zhai,Wenjing Wang,Xi Chen,Tie Zhang

Journal:

BMC Veterinary Research

Year:

2024

Abstract:

Background: Avian influenza virus (AIV) not only causes huge economic losses to the poultry industry, but also threatens human health. Reverse transcription recombinase-aided amplification (RT-RAA) is a novel isothermal nucleic acid amplification technology. This study aimed to improve the detection efficiency of H5, H7, and H9 subtypes of AIV and detect the disease in time. This study established RT-RAA-LFD and real-time fluorescence RT-RAA (RF-RT-RAA) detection methods, which combined RT-RAA with lateral flow dipstick (LFD) and exo probe respectively, while primers and probes were designed based on the reaction principle of RT-RAA. Results: The results showed that RT-RAA-LFD could specifically amplify H5, H7, and H9 subtypes of AIV at 37 °C, 18 min, 39 °C, 20 min, and 38 °C, 18 min, respectively. The sensitivity of all three subtypes for RT-RAA-LFD was 102 copies/µL, which was 10 ∼100 times higher than that of reverse transcription polymerase chain reaction (RT-PCR) agarose electrophoresis method. RF-RT-RAA could specifically amplify H5, H7, and H9 subtypes of AIV at 40 °C, 20 min, 38 °C, 16 min, and 39 °C, 17 min, respectively. The sensitivity of all three subtypes for RF-RT-RAA was 101 copies/µL, which was consistent with the results of real-time fluorescence quantification RT-PCR, and 100 ∼1000 times higher than that of RT-PCR-agarose electrophoresis method. The total coincidence rate of the two methods and RT-PCR-agarose electrophoresis in the detection of clinical samples was higher than 95%. Conclusions: RT-RAA-LFD and RF-RT-RAA were successfully established in this experiment, with quick response, simple operation, strong specificity, high sensitivity, good repeatability, and stability. They are suitable for the early and rapid diagnosis of Avian influenza and they have positive significance for the prevention, control of the disease, and public health safety.