RPB0339

Pathogen Description

Target Pathogen Pathogen Name NCBI Taxonomy ID Order Family Genus Species Pathogen type
SARS-CoV-2 SARS-CoV-2, 2019-nCoV, COVID-19, COVID-19 virus, SARS2, Wuhan coronavirus, Human coronavirus 2019, COVID19, HCoV-19, SARS-2, SARS-CoV4 2697049 Nidovirales Coronaviridae Betacoronavirus Severe acute respiratory syndrome-related coronavirus virus

Primer Description

Primer Name Sequence(5'-3') Length(bp) Primer Final Concentration(μM） GC Content（%） Predicted Melting Temperature(℃） Molecular Weight(g/moles) Positions in GenBank accession number
RPA forward primer AAGGAAATTTTGGGGACCAGGAACTAATCAGA 32 10 μM 40.63 60.73 9954.56 \
RPA reverse primer ATCCAATTTGATGGCACCTGTGTAGGTCAAC 31 10 μM 45.16 62.26 9510.24 \
RT-primer1 TCTTTGAAATTTGGATCTTTGTC 23 100 μM 30.43 48.22 7025.63 \
RT-primer2 GAAATTTGGATCTTTGTC 18 100 μM 33.33 41.94 5519.66 \
RT-primer3 GTTGGTGGGAATGTTTTG 18 100 μM 44.44 48.63 5631.71 \

Gene Description

Target Gene GenBank ID
N gene \

Assay Description

Application Assay Primer Designing Software Reaction Time(min) Assay Temperature(℃) Readout System(s) Limit of Detection(LoD) Sensitivity(%) Specificity(%)
a simple, rapid, sensitive, and stable Cas12a one-step assay. RPA\CRISPR\Cas12a \ 30 min 39 °C CRISPR\Cas12 5 aM 0.975 1

Publication Description

Year of Publication Title Author(s) Journal PMID DOI
2024 Sensitive and visual detection of SARS-CoV-2 using RPA-Cas12a one-step assay with ssDNA-modified crRNA Qinlong Zeng,Miaojin Zhou,Weiheng Deng,Qian Gao,Zhuo Li,Lingqian Wu,Desheng Liang Analytica Chimica Acta 38772660 10.1016/j.aca.2024.342693

Sensitive and visual detection of SARS-CoV-2 using RPA-Cas12a one-step assay with ssDNA-modified crRNA

Author(s):

Qinlong Zeng,Miaojin Zhou,Weiheng Deng,Qian Gao,Zhuo Li,Lingqian Wu,Desheng Liang

Journal:

Analytica Chimica Acta

Year:

2024

Abstract:

Background: CRISPR-Cas12a based one-step assays are widely used for nucleic acid detection, particularly for pathogen detection. However, the detection capability of the one-step assay is reduced because the Cas12a protein competes with the isothermal amplification enzymes for the target DNA and cleaves it. Therefore, the key to improving the sensitivity of the one-step assay is to address the imbalance between isothermal amplification and CRISPR detection. In previous study, we developed a Cas12a one-step assay using single-stranded DNA (ssDNA)-modified crRNA (mD-crRNA) and applied this method for the detection of pathogenic DNA. Results: Here, we utilized mD-crRNA to establish a sensitive one-step assay that enables the visual detection of SARS-CoV-2 under ultraviolet light, achieving a detection limit of 5 aM without cross-reactivity. The sensitivity of mD-crRNA in the one-step assay was 100-fold higher than that of wild-type crRNA. Mechanistic studies revealed that the addition of ssDNA at the 3' end of mD-crRNA attenuates the binding affinity between the Cas12a-mD-crRNA complex and the target DNA. Consequently, this reduction in binding affinity decreases the cis-cleavage activity of Cas12a, mitigating its cleavage of the target DNA in the one-step assay. As a result, there is an augmentation in the amplification and accumulation of target DNA, thereby enhancing detection sensitivity. In the clinical testing of 40 SARS-CoV-2 RNA samples, the concordance between the results of the one-step assay and known qPCR results was 97.5 %. Significance: The one-step assay using mD-crRNA proves to be highly sensitive and specificity and visually effective for the detection of SARS-CoV-2. Our study delves into the application of the mD-crRNA-mediated one-step assay in nucleic acid detection and its associated reaction mechanism. This holds great significance in addressing the inherent incompatibility issues between isothermal amplification and CRISPR detection.